Polystira starretti

Petuch, 2002 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Turridae/Polystira

At a glance

Occurrence records282

Data sources9

Biological traits5

DNA specimens35

eDNA detections35

Sources9 archives

Databases and archives Polystira starretti's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

OBISOcean Biodiversity Information System100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS282 records

Environmental DNA1 datasets · 6 countries35 detections

DNA & barcodingBOLD35 specimens

01Narrative

Polystira starretti is a species of sea snail, a marine gastropod mollusk in the family Turridae, the turrids.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.9 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max400 m

Depth min400 m

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polystira starretti has left across the world's sequence archives.

At a glance

DNA specimens35

BINs1

Marker genes1

eDNA detections35

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

1Gmostly conserved

76Avariable

169Amostly conserved

175Avariable

199Amostly conserved

212Cmostly conserved

247Cmostly conserved

250Cmostly conserved

278Cmostly conserved

290Cmostly conserved

301Tmostly conserved

322Gmostly conserved

373Tmostly conserved

529Tmostly conserved

544Amostly conserved

556Amostly conserved

562Amostly conserved

574Gmostly conserved

619Amostly conserved

634Cmostly conserved

649Amostly conserved

655Gvariable

GACATTATATATCTTATTTGGTATGTGATCTGGATTAGTAGGTACTGCCTTAAGTCTTCTTATTCGGGCTGAATTAGGACAGCCTGGGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes21

BIN1

Most divergent pair2.0%

S.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polystira artiasame genus5.1%Polystira florencaesame genus7.6%Polystira oxytropissame genus10.1%Polystira coltrorumsame genus11.1%Polystira pictasame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type282 records

Museum / vouchered282

Range

Area of Occupancy AOO416 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 116.5 m · max 116.5 m · 1 record with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 280 without coordinates

Open the institutions mapphysical evidence282

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	99
Washington, US	32
Paris, FR	25
Chicago, US	3

4 institutions · 159 of 282 vouchered records shown · 23 without an institution code

09Environmental DNA35 detections

Where the DNA of Polystira starretti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 26.0–26.7

Seasonal swing summer↔winter1.90 °C

Max temp (day)27.1 °C 26.9–30.2

Min temp (night)25.7 °C 22.4–25.9

Precipitation180 mm/mo 105–201

Air humidity63.4 % 62.3–64.6

Vapour deficit1,260 Pa 1,177–1,319

Cloud cover28.1 % 27.0–30.6

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)