Polystira coltrorum

Petuch, 1993 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Neogastropoda/Turridae/Polystira

At a glance

Occurrence records52

Data sources9

Biological traits5

DNA specimens16

eDNA detections1

Sources9 archives

Databases and archives Polystira coltrorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

OBISOcean Biodiversity Information System9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS52 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD16 specimens

01Narrative

Polystira coltrorum is a species of sea snail, a marine gastropod mollusk in the family Turridae, the turrids.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length2.2 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max40 m

Depth min40 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Polystira coltrorum has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

13Cmostly conserved

25Gmostly conserved

35Tmostly conserved

97Tmostly conserved

265Cmostly conserved

361Gmostly conserved

428Tvariable

445Cmostly conserved

517Cmostly conserved

548Tvariable

608Tvariable

628Tmostly conserved

652Tmostly conserved

GACATTATATATCTTATTTGGTATGTGATCTGGTTTAGTAGGTACTGCTTTAAGTCTACTTATTCGGGCAGAATTAGGACAACCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.51%

Haplotypes10

BIN1

Most divergent pair1.1%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polystira albidasame genus2.3%Polystira nobilissame genus6.4%Polystira telleasame genus8.1%Polystira pictasame genus11.0%Polystira starrettisame genus11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type52 records

Museum / vouchered52

Range

Area of Occupancy AOO72 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 50 m · max 180 m · 6 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 3>10 km 2

5 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence52

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	19
Natural History Museum Rotterdamlocation not on record	3
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	3
Denver, US	1
Chongqing Museumlocation not on record	1

5 institutions · 27 of 52 vouchered records shown · 15 without an institution code

09Environmental DNA1 detections

Where the DNA of Polystira coltrorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)