Podiceps occipitalis

Garnot, 1826 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Podicipediformes/Podicipedidae/Podiceps

At a glance

Occurrence records47 051

Data sources8

Biological traits23

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Podiceps occipitalis's data was compiled from.

WikipediaWikimedia Foundation13 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 051 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF47 051 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The silvery grebe (Podiceps occipitalis) is a species of grebe in the family Podicipedidae. It is found in the western and southern part of South America at altitudes of up to 4000 m. Its natural habitat is freshwater lakes but it also feeds in saline lakes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth5.9 mm

Beak length (culmen)23.1 mm

Beak length (nares)11.8 mm

Beak width5 mm

Body mass321 g

Body mass (female)307 g

Body mass (male)335 g

Hand-wing index39.4

Kipp's distance49.1 mm

Secondary length75.6 mm

Tail length31 mm

Tarsus length37.3 mm

Wing length126 mm

Diet & foraging6

Fish10 %

Invertebrate90 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Water around surface50 %

Water below surface50 %

Habitat & environment4

HabitatWetland

Migration1.0

Primary lifestyleAquatic

Range size1 750 480 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Podiceps occipitalis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.19%

Haplotypes2

BIN1

Most divergent pair0.29%

Where individuals differ — all 2 variable positions, in barcode order

415Gvariable

559Cvariable

CCTATACCTAATCTTTGGCGCATGAGCCGGCATAGTCGGCACCGCCCTAAGCCTACTCATCCGCGCAGAACTAGGCCAACCAGGAACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Podiceps nigricollissame genus1.5%Aechmophorus clarkiisame family5.5%Rollandia rollandsame family5.5%Podiceps grisegenasame genus6.2%Podiceps cristatussame genus6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type47 051 records

Wild obs. + sensor46 989

Museum / vouchered62

Origin

Native21

Range

Area of Occupancy AOO19 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 591≤1 km 430≤10 km 410>10 km 124

1 555 georeferenced · 45 434 without coordinates

Open the mapobservation + sensor46 989

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 4≤10 km 33>10 km 6

43 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	17
Copenhagen, DK	14
Buenos Aires, AR	13
Moore Laboratory of Zoology, Occidental Collegelocation not on record	8
Louisiana State University, Museum of Zoologylocation not on record	7
Valparaiso, CL	1
Musée des Confluenceslocation not on record	1
Barcelona, ES	1

8 institutions · 62 of 62 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Podiceps occipitalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 6.50–14.2

Seasonal swing summer↔winter13.6 °C

Max temp (day)18.5 °C 10.2–20.4

Min temp (night)8.70 °C 3.10–8.80

Precipitation23.9 mm/mo 6.40–172

Air humidity47.1 % 42.5–63.0

Moisture balance-92.3 mm/mo -110–114

Vapour deficit875 Pa 401–893

Wind speed4.70 m/s 2.30–5.40

Cloud cover28.7 % 24.2–36.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Podiceps occipitalis

At a glance

Sources8 archives

Size & morphology13

Diet & foraging6

Habitat & environment4

At a glance

Record type47 051 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type47 051 records