Aechmophorus clarkii

(Lawrence, 1858) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Podicipediformes/Podicipedidae/Aechmophorus

At a glance

Occurrence records305 208

Data sources12

Biological traits33

DNA specimens3

eDNA detections0

Sources12 archives

Databases and archives Aechmophorus clarkii's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 200 records↗

OBISOcean Biodiversity Information System8 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF · OBIS305 208 records

DNA & barcodingBOLD3 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Clark's grebe (Aechmophorus clarkii) is a North American waterbird species in the grebe family. Until the 1980s, it was thought to be a pale morph of the western grebe, which it resembles in size, range, and behavior. Intermediates between the two species are known. This species nests on large inland lakes in western North America and migrates to the Pacific coast over the winter. It maintains local populations year-round in California, Nevada, and Arizona (the Lower Colorado River Valley), as well as in central Mexico. It feeds by diving for insects, polychaete worms, crustaceans, and salamanders. It performs the same elaborate courtship display as the western grebe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBAVONETEltonTraits

Size & morphology13

Beak depth11.6 mm

Beak length (culmen)77.9 mm

Beak length (nares)58.8 mm

Beak width7.5 mm

Body mass1 260 g

⚠ sources differ — AmnioteDB: 1 260 g · AVONET: 1 091 g · EltonTraits: 1 091 g

Body mass (female)1 066 g

Body mass (male)1 283 g

Hand-wing index41.8

Kipp's distance79.8 mm

Secondary length112 mm

Tail length34 mm

Tarsus length76.6 mm

Wing length195 mm

Life cycle & reproduction11

Age at maturity (male)365 days

Age at sexual maturity365 days

Egg length57.6 mm

Egg mass43.5 g

Egg width38.8 mm

Fledging age70 days

Incubation23 days

Litter size3

Litters per year1.25 /year

Max. longevity168 months

Neonate mass30.7 g

Diet & foraging5

Fish90 %

Invertebrate10 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Water below surface100 %

Habitat & environment4

HabitatWetland

Migration3.0

Primary lifestyleAquatic

Range size3 589 069 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aechmophorus clarkii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P694 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

664Tvariable

CCTGTACTTAATCTTCGGCGCATGAGCCGGCATAGTCGGCACTGCCCTAAGCCTACTCATCCGCGCAGAACTAGGCCAACCAGGAACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Podiceps nigricollissame family4.9%Podiceps occipitalissame family5.5%Rollandia rollandsame family5.8%Podiceps auritussame family6.2%Podiceps cristatussame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aechmophorus clarkii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 671 505 086 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aechmophorus clarkii1.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type305 208 records

Wild obs. + sensor304 873

Museum / vouchered335

Origin

Native85

Range

Area of Occupancy AOO39 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 2 451≤1 km 1 930≤10 km 549>10 km 114

5 044 georeferenced · 299 829 without coordinates

Open the mapobservation + sensor304 873

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 6≤1 km 10≤10 km 107>10 km 57

180 georeferenced · 155 without coordinates

Open the institutions mapphysical evidence335

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	171
CASlocation not on record	32
Seattle, US	27
Washington State University, Charles R. Conner Museumlocation not on record	22
Los Angeles, US	15
San Diego, US	13
Washington, US	8
München, DE	8
Denver, US	4
Zacatecas, MX	4
Philadelphia, US	4
Moore Laboratory of Zoology, Occidental Collegelocation not on record	3
Wuzhou, CN	2
New Haven, US	2
Chicago, US	2
Tacoma, US	2
Toronto, CA	2
Louisiana State University, Museum of Zoologylocation not on record	2
	2
Ithaca, US	1
Iowa City, US	1
Albany, US	1
ASNHClocation not on record	1
Museo de Historia Natural Alfredo Dugés, Universidad de Guanajuatolocation not on record	1
University of Nebraska State Museumlocation not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1

26 institutions · 332 of 335 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aechmophorus clarkii

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction11

Diet & foraging5

Habitat & environment4

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type305 208 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 26 geolocated

Record type305 208 records