Pleromelloida conserta

Grote, 1881 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Pleromelloida

At a glance

Occurrence records762

Data sources7

Biological traits0

DNA specimens20

eDNA detections20

Sources7 archives

Databases and archives Pleromelloida conserta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF762 records

Environmental DNA1 datasets · 2 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Pleromelloida conserta is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1881. It is found in North America from British Columbia to California, east to Utah, north to Saskatchewan. Until recently, the black form P. conserta and the grey form P. obliquata were treated as separate species. The wingspan is 30–33 mm. Adults are on wing in spring. There is one generation per year. The larvae feed on the leaves of Symphoricarpos species, including Symphoricarpos albus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pleromelloida conserta has left across the world's sequence archives.

At a glance

DNA specimens20

BINs4

Marker genes1

eDNA detections20

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

1Cvariable

28Avariable

37Avariable

59Cmostly conserved

106Tmostly conserved

133Tvariable

211Avariable

223Tvariable

242Avariable

259Tmostly conserved

266Cvariable

268Gvariable

340Cvariable

364Cvariable

367Tvariable

376Avariable

391Cvariable

412Avariable

415Avariable

463Tvariable

477Amostly conserved

517Avariable

616Cmostly conserved

631Amostly conserved

634Cvariable

646Tmostly conserved

652Cvariable

658Tmostly conserved

CACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGTGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes9

BINs4

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pleromelloida bonusculasame genus3.2%Pleromelloida arizonatasame genus3.5%Pleromelloida cinereasame genus3.8%Bryophila tephrocharissame family5.2%Lythrodes tripunctasame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor331

Museum / vouchered431

Range

Area of Occupancy AOO1 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 186≤1 km 40≤10 km 17>10 km 19

262 georeferenced · 69 without coordinates

Open the mapobservation + sensor331

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 93≤1 km 1≤10 km 23>10 km 1

118 georeferenced · 313 without coordinates

Open the institutions mapphysical evidence431

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Arthropod Collectionlocation not on record	120
University of Alberta Museums (UAM)location not on record	104
Colorado State Universitylocation not on record	91
Vernal, US	37
New Haven, US	23
Royal Saskatchewan Museumlocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
ASUlocation not on record	5
San Francisco, US	3
Mississippi State, US	2
Helsinki, FI	2
St. Paul, US	2
California Academy of Scienceslocation not on record	1
San Diego, US	1
Essig Museum of Entomologylocation not on record	1

16 institutions · 422 of 431 vouchered records shown · 9 without an institution code

09Environmental DNA20 detections

Where the DNA of Pleromelloida conserta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 5.10–12.9

Seasonal swing summer↔winter13.1 °C

Max temp (day)15.9 °C 8.10–19.4

Min temp (night)4.40 °C 0.6–7.60

Precipitation95.0 mm/mo 47.7–198

Air humidity57.8 % 49.9–61.7

Moisture balance37.6 mm/mo -73.3–133

Vapour deficit518 Pa 339–791

Wind speed2.10 m/s 1.90–2.90

Cloud cover45.2 % 37.1–54.4

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)