Pleromelloida cinerea

Smith, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Pleromelloida

At a glance

Occurrence records432

Data sources7

Biological traits0

DNA specimens13

eDNA detections11

Sources7 archives

Databases and archives Pleromelloida cinerea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF432 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Pleromelloida cinerea, the ashy pleromelloida, is a species of moth in the family Noctuidae (the owlet moths). It is found in North America. The MONA or Hodges number for Pleromelloida cinerea is 10031.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pleromelloida cinerea has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

38Gmostly conserved

88Gmostly conserved

92Tmostly conserved

109Gvariable

217Tmostly conserved

226Tmostly conserved

232Tmostly conserved

268Tmostly conserved

313Tvariable

367Tmostly conserved

379Tmostly conserved

526Amostly conserved

622Tmostly conserved

628Amostly conserved

TACATTATATTTTATTTTTGGTATCTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGTGCTGAATTAGGAAACCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes3

BINs2

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pleromelloida arizonatasame genus2.4%Pleromelloida consertasame genus3.8%Pleromelloida bonusculasame genus4.9%Bryophila tephrocharissame family6.6%Behrensia conchiformissame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type432 records

Wild obs. + sensor163

Museum / vouchered269

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 82≤1 km 16≤10 km 18>10 km 9

125 georeferenced · 38 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 40≤1 km 11≤10 km 24>10 km 4

79 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence269

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	61
Oregon State Arthropod Collectionlocation not on record	41
Colorado State Universitylocation not on record	37
San Diego, US	34
Vernal, US	28
ASUlocation not on record	14
New Haven, US	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	10
Mississippi State, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
WWUlocation not on record	4
Helsinki, FI	3
Denver, US	1
San Francisco, US	1
St. Paul, US	1
Centre for Biodiversity Genomicslocation not on record	1

16 institutions · 259 of 269 vouchered records shown · 10 without an institution code

09Environmental DNA11 detections

Where the DNA of Pleromelloida cinerea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C -1.40–12.9

Seasonal swing summer↔winter26.5 °C

Max temp (day)17.1 °C 2.70–20.1

Min temp (night)6.60 °C -5.30–10.2

Precipitation32.2 mm/mo 28.7–96.5

Air humidity60.6 % 54.4–61.8

Moisture balance18.5 mm/mo -20.9–19.1

Vapour deficit585 Pa 217–661

Wind speed1.70 m/s 1.60–1.90

Cloud cover47.2 % 41.5–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)