Plagiognathus arbustorum

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Plagiognathus

At a glance

Occurrence records28 290

Data sources7

Biological traits0

DNA specimens80

eDNA detections420

Sources7 archives

Databases and archives Plagiognathus arbustorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 290 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI420 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics80 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 290 records

Environmental DNA4 datasets · 15 countries420 detections

DNA & barcodingBOLD80 specimens

01Narrative

Plagiognathus arbustorum is a species of insects in the family Miridae, the plant bugs.BioLib Catalogue of life

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding80 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagiognathus arbustorum has left across the world's sequence archives.

At a glance

DNA specimens80

BINs1

Marker genes1

eDNA detections420

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

50Tvariable

338Tmostly conserved

386Gmostly conserved

CTCTATATTTTATATTCGGAATATGGGCAGGAATATTAGGAACTTCACTTAGATGAATCATTCGTATTGAATTAGGAATACCTGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes11

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagiognathus chrysanthemisame genus9.5%Plagiognathus tumidifronssame genus10.1%Plagiognathus shoshoneasame genus10.2%Plagiognathus brunneussame genus10.2%Plagiognathus obscurussame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 290 records

Wild obs. + sensor26 572

Museum / vouchered1 604

Cultivated / captive5

Other109

Range

Area of Occupancy AOO38 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 8 458≤1 km 3 569≤10 km 12 151>10 km 209

24 387 georeferenced · 2 185 without coordinates

Open the mapobservation + sensor26 572

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 691≤1 km 473≤10 km 235>10 km 1

1 400 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence1 604

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	260
NCMGlocation not on record	132
Natural History Museum, Aarhus Denmarklocation not on record	98
SLU Artdatabankenlocation not on record	84
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	79
Philadelphia, US	65
CBDClocation not on record	44
Tartu, EE	36
Tallinn, EE	24
Rovaniemi, FI	23
Jyväskylä, FI	22
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	21
Bonn, DE	20
Tromsø, NO	19
ZMAAlocation not on record	18
neflocation not on record	18
Metsähallituslocation not on record	16
Uniwersytet Śląski w Katowicachlocation not on record	14
Forssa, FI	7
Ugentlocation not on record	6
ZSMlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	5
UO-CeStuBiolocation not on record	5
Helsinki, FI	5
European Distributed Institute of Taxonomy (EDIT)location not on record	4
BioFokuslocation not on record	3
WGSlocation not on record	3
Nagatoro-machi, Chichibu-gun, JP	3
Natural History Museum Rotterdamlocation not on record	1
Natural History Museum, Londonlocation not on record	1
National Museum of Scotlandlocation not on record	1
South Kensington, GB	1
Trondheim, NO	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1

34 institutions · 1 046 of 1 604 vouchered records shown · 558 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA420 detections

Where the DNA of Plagiognathus arbustorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found420

Studies independent surveys4

Countries15

Verifiable raw sequence linked313

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 420 detections have coordinates

Open the map15 countries0

Urbanpuisto

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 13.4–17.4

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.0 °C 16.5–21.4

Min temp (night)12.8 °C 9.80–13.8

Precipitation76.7 mm/mo 54.1–102

Air humidity60.7 % 58.5–63.0

Moisture balance-29.6 mm/mo -66.1–23.3

Vapour deficit724 Pa 589–809

Wind speed3.10 m/s 2.30–4.20

Cloud cover47.3 % 39.7–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 419 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Plagiognathus arbustorum

At a glance

Sources7 archives

At a glance

Record type28 290 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 290 records