Plagiognathus obscurus

Uhler, 1872 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Plagiognathus

At a glance

Occurrence records777

Data sources6

Biological traits0

DNA specimens40

eDNA detections6

Sources6 archives

Databases and archives Plagiognathus obscurus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility777 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF777 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD40 specimens

01Narrative

Plagiognathus obscurus, the obscure plant bug, is a species of plant bug in the family Miridae. It is found in North America and South America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagiognathus obscurus has left across the world's sequence archives.

At a glance

DNA specimens40

BINs4

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

5Tmostly conserved

13Tvariable

22Gmostly conserved

28Gmostly conserved

74Cmostly conserved

79Cvariable

88Amostly conserved

106Cmostly conserved

115Cmostly conserved

130Tmostly conserved

170Avariable

178Tvariable

202Cmostly conserved

274Cmostly conserved

284Tmostly conserved

313Cmostly conserved

325Cvariable

340Tmostly conserved

343Tmostly conserved

361Cmostly conserved

401Tmostly conserved

469Amostly conserved

473Gmostly conserved

475Cmostly conserved

484Tmostly conserved

496Cmostly conserved

500Tmostly conserved

536Tmostly conserved

539Cmostly conserved

553Cmostly conserved

565Gvariable

578Cmostly conserved

625Amostly conserved

646Tmostly conserved

653Tmostly conserved

CACTTTATATTTTATATTTGGGATATGGGCAGGGATATTAGGAACTTCACTTAGATGAATCATCCGTATTGAACTAGGCATACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes4

BINs4

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagiognathus morrisonisame genus3.8%Rhinocapsus vanduzeeisame family4.0%Plagiognathus fuscipessame genus4.0%Plagiognathus punctatipessame genus4.6%Plagiognathus cornicolasame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type777 records

Wild obs. + sensor487

Museum / vouchered290

Range

Area of Occupancy AOO1 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 274≤1 km 76≤10 km 16>10 km 27

393 georeferenced · 94 without coordinates

Open the mapobservation + sensor487

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 168≤10 km 36

206 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	202
College Station, US	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Edmonton, CA	6
Natural History Museum of Utahlocation not on record	4
Centre for Biodiversity Genomicslocation not on record	2
Albuquerque, US	1
University of Guelphlocation not on record	1
Washington, US	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
North Carolina State University Insect Museumlocation not on record	1

12 institutions · 242 of 290 vouchered records shown · 48 without an institution code

09Environmental DNA6 detections

Where the DNA of Plagiognathus obscurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 13.2–14.9

Seasonal swing summer↔winter24.7 °C

Max temp (day)19.8 °C 19.1–20.4

Min temp (night)9.60 °C 7.90–11.3

Precipitation94.3 mm/mo 83.7–105

Air humidity57.2 % 54.8–59.6

Moisture balance-20.1 mm/mo -25.7–-14.5

Vapour deficit686 Pa

Wind speed3.50 m/s 3.20–3.80

Cloud cover43.7 % 40.3–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)