Placochilus seladonicus

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Placochilus

At a glance

Occurrence records1 076

Data sources5

Biological traits2

DNA specimens12

eDNA detections12

Sources5 archives

Databases and archives Placochilus seladonicus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 076 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 076 records

Environmental DNA2 datasets · 6 countries12 detections

DNA & barcodingBOLD12 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Placochilus seladonicus has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes2

eDNA detections12

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

1Cmostly conserved

10Cmostly conserved

13Tmostly conserved

19Cmostly conserved

23Amostly conserved

31Amostly conserved

34Gvariable

46Tmostly conserved

52Tmostly conserved

61Cmostly conserved

64Cmostly conserved

73Gmostly conserved

74Cmostly conserved

82Gmostly conserved

85Gmostly conserved

88Gmostly conserved

94Cmostly conserved

121Tmostly conserved

133Amostly conserved

136Cmostly conserved

142Cmostly conserved

151Tmostly conserved

163Tmostly conserved

172Tmostly conserved

181Amostly conserved

199Amostly conserved

202Cmostly conserved

205Gmostly conserved

223Amostly conserved

232Amostly conserved

235Cmostly conserved

238Gmostly conserved

266Tmostly conserved

274Amostly conserved

277Amostly conserved

283Amostly conserved

343Tmostly conserved

562Gmostly conserved

625Amostly conserved

628Gmostly conserved

CACTTTATACTTTATATTCGGAATATGAGCAGGGATACTAGGAACTTCACTTAGATGAATCATCCGTATTGAGCTAGGTATGCCGGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes4

BINs2

Most divergent pair5.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagiognathus obscurussame family10.3%Plagiognathus punctatipessame family10.4%Plagiognathus shoshoneasame family10.6%Plagiognathus brunneussame family10.6%Plagiognathus chrysanthemisame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 076 records

Wild obs. + sensor864

Museum / vouchered197

Cultivated / captive1

Other14

Range

Area of Occupancy AOO2 920 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 492≤1 km 258≤10 km 59>10 km 15

824 georeferenced · 40 without coordinates

Open the mapobservation + sensor864

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 84≤1 km 33≤10 km 47

164 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence197

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum, Aarhus Denmarklocation not on record	43
SLU Artdatabankenlocation not on record	27
NHMOlocation not on record	24
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	14
Philadelphia, US	10
MZLUlocation not on record	8
neflocation not on record	4
Tartu, EE	3
Jyväskylä, FI	3
WGSlocation not on record	2
Bonn, DE	2
Tallinn, EE	1
BioFokuslocation not on record	1
Kuopio, FI	1
ZMAAlocation not on record	1

15 institutions · 144 of 197 vouchered records shown · 53 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Placochilus seladonicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries6

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 6.60–20.2

Seasonal swing summer↔winter20.5 °C

Max temp (day)17.7 °C 11.4–24.6

Min temp (night)12.2 °C 1.20–15.4

Precipitation89.2 mm/mo 72.1–242

Air humidity61.6 % 56.9–63.4

Moisture balance-21.4 mm/mo -63.7–148

Vapour deficit675 Pa 361–1,025

Wind speed2.80 m/s 2.10–5.70

Cloud cover38.0 % 35.6–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Placochilus seladonicus

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 076 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 076 records