Phyllonorycter celtisella

(Chambers, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Phyllonorycter

At a glance

Occurrence records51

Data sources7

Biological traits0

DNA specimens9

eDNA detections8

Sources7 archives

Databases and archives Phyllonorycter celtisella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility51 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF51 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Phyllonorycter celtisella is a moth of the family Gracillariidae. It is known from Ontario in Canada and Connecticut, Illinois, Kentucky, Ohio, Oklahoma, and Texas in the United States.Global Taxonomic Database of Gracillariidae (Lepidoptera) The larvae feed on Celtis species, including Celtis occidentalis. They mine the leaves of their host plant. The mine has the form of a blotch mine on the upperside of the leaf. The larva, of the cylindrical type in the later stages, enters the leaf on the lower surface, and makes a narrow linear mine, then cuts through the parenchyma to the upper side, where the mine broadens into an elongate blotch, made tent-like by a longitudinal ridge in each epidermis. The larvae eat the entire parenchyma, leaving merely the dark discoloured cuticles of the leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllonorycter celtisella has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

5Cmostly conserved

6Tmostly conserved

7Tmostly conserved

8Tmostly conserved

9Amostly conserved

12Tmostly conserved

13Tvariable

14Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

26Tmostly conserved

29Gmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

45Cmostly conserved

46Cvariable

47Tmostly conserved

48Cmostly conserved

50Tmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Amostly conserved

57Tmostly conserved

58Tmostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Amostly conserved

68Gmostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

83Cmostly conserved

84Cmostly conserved

85Amostly conserved

89Tmostly conserved

90Cmostly conserved

205Tmostly conserved

268Amostly conserved

287Cvariable

364Amostly conserved

373Cvariable

376Gmostly conserved

496Avariable

533Cmostly conserved

565Amostly conserved

601Tmostly conserved

602Amostly conserved

603Cmostly conserved

604Tmostly conserved

606Cmostly conserved

607Amostly conserved

608Tmostly conserved

610Cmostly conserved

628Gvariable

AACACTTTATTTTATTTTTGGAATTTGAGCAGGAATAATTGGATCCTCTTTAAGAATTTTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllonorycter tristrigellasame genus9.0%Phyllonorycter celtifoliellasame genus9.1%Phyllonorycter pumilaesame genus9.4%Phyllonorycter zelkovaesame genus9.9%Phyllonorycter nigristellasame genus10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor35

Museum / vouchered16

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 14≤1 km 4≤10 km 3

21 georeferenced · 14 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	8
Philadelphia, US	4
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2

4 institutions · 16 of 16 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Phyllonorycter celtisella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 17.4–27.4

Seasonal swing summer↔winter26.7 °C

Max temp (day)26.0 °C 23.7–33.0

Min temp (night)22.1 °C 13.0–23.1

Precipitation85.5 mm/mo 78.9–107

Air humidity56.8 % 54.6–59.7

Moisture balance-69.2 mm/mo -116–-34.4

Vapour deficit1,208 Pa 873–1,665

Wind speed4.10 m/s 3.80–5.60

Cloud cover35.1 % 27.2–37.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)