Phyllonorycter celtifoliella

(Chambers, 1871) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Phyllonorycter

At a glance

Occurrence records73

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Phyllonorycter celtifoliella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF73 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Phyllonorycter celtifoliella is a moth of the family Gracillariidae. It is known from Illinois, Kentucky, Ohio, West Virginia, Florida, Georgia, Maryland and Texas in the United States.Global Taxonomic Database of Gracillariidae (Lepidoptera) The larvae feed on Celtis species, including Celtis occidentalis. They mine the leaves of their host plant. The mine has the form of a tentiform mine on the underside of the leaf. The mine, lies between two veins and is somewhat variable in shape. The pupa is suspended in a few silken threads.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllonorycter celtifoliella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 6 variable positions, in barcode order

181Amostly conserved

217Avariable

370Avariable

415Gmostly conserved

434Gmostly conserved

478Avariable

AACACTTTATTTTATTTTTGGTATTTGAGCAGGAATAATTGGATCTTCTTTAAGAATTATAATTCGAGCAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllonorycter nicelliisame genus7.1%Phyllonorycter similissame genus7.1%Phyllonorycter manniisame genus7.8%Phyllonorycter tritorrhectasame genus7.9%Phyllonorycter maestingellasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type73 records

Wild obs. + sensor50

Museum / vouchered23

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 16≤1 km 10≤10 km 5>10 km 4

35 georeferenced · 15 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	8
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Philadelphia, US	4
St. Paul, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

5 institutions · 20 of 23 vouchered records shown · 3 without an institution code

09Environmental DNA10 detections

Where the DNA of Phyllonorycter celtifoliella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 12.4–25.8

Seasonal swing summer↔winter26.1 °C

Max temp (day)24.0 °C 14.5–31.0

Min temp (night)14.2 °C 11.0–21.1

Precipitation79.6 mm/mo 74.8–108

Air humidity59.3 % 56.9–59.4

Moisture balance-22.4 mm/mo -75.8–-21.7

Vapour deficit899 Pa 585–1,405

Wind speed4.40 m/s 2.70–7.20

Cloud cover40.8 % 29.3–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)