Phostria latiapicalis

Schaus, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Phostria

At a glance

Occurrence records70

Data sources6

Biological traits0

DNA specimens79

eDNA detections80

Sources6 archives

Databases and archives Phostria latiapicalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI80 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics79 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF70 records

Environmental DNA1 datasets · 2 countries80 detections

DNA & barcodingBOLD79 specimens

01Narrative

Phostria latiapicalis is a moth in the family Crambidae. It is found in Costa Rica and Panama.BOLD Systems

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding79 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phostria latiapicalis has left across the world's sequence archives.

At a glance

DNA specimens79

BINs1

Marker genes1

eDNA detections80

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

169Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGTACATCTTTAAGTTTACTAATTCGAGCAGAATTAGGTAACCCAGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes7

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Antigastra catalaunalissame family6.7%Nausinoe geometralissame family7.0%Dichocrocis sabatialissame family7.3%Pilocrocis sororalissame family7.6%Udea ruckdeschelisame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type70 records

Museum / vouchered70

Range

Area of Occupancy AOO120 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 70 records without

Open the institutions mapphysical evidence70

10Collections & institutions

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	54

1 institutions · 54 of 70 vouchered records shown · 16 without an institution code

09Environmental DNA80 detections

Where the DNA of Phostria latiapicalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found80

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 80 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.6. Subtropical/Tropic…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 23.3–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.5 °C 25.6–29.6

Min temp (night)21.9 °C 21.0–23.2

Precipitation313 mm/mo 63.4–477

Air humidity70.3 % 64.4–75.7

Moisture balance166 mm/mo -99.3–341

Vapour deficit924 Pa 705–1,172

Wind speed2.10 m/s 1.10–3.80

Cloud cover36.2 % 16.0–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)