Antigastra catalaunalis

(Duponchel, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Antigastra

At a glance

Occurrence records3 888

Data sources6

Biological traits0

DNA specimens68

eDNA detections58

Sources6 archives

Databases and archives Antigastra catalaunalis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility3 888 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 888 records

Environmental DNA1 datasets · 18 countries58 detections

DNA & barcodingBOLD68 specimens

01Narrative

Image by Harold Maxwell-Lefroy Antigastra catalaunalis is a species of moth of the family Crambidae. The species was described by Philogène Auguste Joseph Duponchel in 1833. It is endemic to tropical and subtropical areas (South Asia, Malay Archipelago, Africa), but is also found in other areas due to its migratory nature. The wingspan is 19–22 mm.The forewings are pale yellow, veins and margins suffused with ferruginous, sometimes almost obscuring ground-colour; lines ferruginous, second strongly curved outwards on upper 2/3 ; small orbicular and discal spot fuscous ; cilia whitish, base dark fuscous. Hindwings are yellow whitish, ferruginous-tinged, termen more ferruginous ; a cloudy grey postmedian costal spot.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The larvae feed on Antirrhinum, Linaria vulgaris, sesame and Scrophulariaceae and Pedaliaceae species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Antigastra catalaunalis has left across the world's sequence archives.

At a glance

DNA specimens68

BINs4

Marker genes1

eDNA detections58

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

85Cmostly conserved

139Amostly conserved

235Cmostly conserved

265Amostly conserved

271Tvariable

274Tmostly conserved

287Cmostly conserved

340Cmostly conserved

412Gmostly conserved

421Avariable

433Gmostly conserved

436Cmostly conserved

470Gvariable

472Cmostly conserved

475Cmostly conserved

476Gmostly conserved

499Tmostly conserved

532Amostly conserved

544Tmostly conserved

547Cmostly conserved

556Amostly conserved

557Cmostly conserved

562Avariable

578Cmostly conserved

580Amostly conserved

607Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes17

BINs4

Most divergent pair12.5%

EuropeOceaniaAfricaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Piletocera chlorurasame family6.5%Phostria latiapicalissame family6.7%Udea ruckdeschelisame family7.0%Glycythyma chrysoryctasame family7.0%Patania deficienssame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 888 records

Wild obs. + sensor3 731

Museum / vouchered150

Other7

Origin

Native4

Range

Area of Occupancy AOO8 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 781≤1 km 511≤10 km 205>10 km 163

2 660 georeferenced · 1 071 without coordinates

Open the mapobservation + sensor3 731

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 14≤1 km 4≤10 km 33>10 km 10

61 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	33
ZAF-UMUlocation not on record	33
tesrilocation not on record	29
Zürich, CH	22
Radicondoli, IT	4
Naturalis Biodiversity Centerlocation not on record	3
Australian National Insect Collectionlocation not on record	3
DABUHlocation not on record	2
NHMOlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	1
Durban Natural Science Museumlocation not on record	1
Zoologische Staatssammlung Muenchenlocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
Tartu, EE	1
Philadelphia, US	1
Helsinki, FI	1
DPIlocation not on record	1

17 institutions · 139 of 150 vouchered records shown · 11 without an institution code

09Environmental DNA58 detections

Where the DNA of Antigastra catalaunalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Countries18

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map18 countries0

meadow in juniperus forestForestTexas Hill country

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 14.2–27.6

Seasonal swing summer↔winter14.1 °C

Max temp (day)27.2 °C 16.7–32.8

Min temp (night)18.8 °C 10.5–23.2

Precipitation37.1 mm/mo 9.20–120

Air humidity56.7 % 48.0–63.8

Moisture balance-96.6 mm/mo

Vapour deficit1,302 Pa 646–1,782

Wind speed3.30 m/s

Cloud cover30.3 % 16.7–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Antigastra catalaunalis

At a glance

Sources6 archives

At a glance

Record type3 888 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 888 records