Philedonides lunana

(Thunberg & Borgstrm, 1784) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Philedonides

At a glance

Occurrence records715

Data sources10

Biological traits2

DNA specimens23

eDNA detections26

Sources10 archives

Databases and archives Philedonides lunana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility715 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF715 records

Environmental DNA4 datasets · 6 countries26 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · NCBI≈373 Mbp

01Narrative

Philedonides lunana, also known as the heath tortrix and Walker’s Lanark tortrix, is a moth of the family Tortricidae. It was first described by Carl Peter Thunberg in 1784 and is found in most of Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philedonides lunana has left across the world's sequence archives.

At a glance

DNA specimens23

BINs12

Marker genes1

eDNA detections26

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

5Tmostly conserved

19Tmostly conserved

22Amostly conserved

40Amostly conserved

46Tmostly conserved

55Amostly conserved

56Cvariable

73Amostly conserved

82Tmostly conserved

99Gmostly conserved

100Amostly conserved

101Gmostly conserved

106Tvariable

115Tmostly conserved

124Cvariable

136Cvariable

172Tmostly conserved

187Tvariable

197Cmostly conserved

200Gmostly conserved

202Tmostly conserved

217Amostly conserved

220Cmostly conserved

229Amostly conserved

235Tvariable

241Tvariable

268Tmostly conserved

280Tmostly conserved

282Tmostly conserved

284Tmostly conserved

304Cvariable

307Amostly conserved

318Cmostly conserved

334Amostly conserved

337Amostly conserved

343Cvariable

346Tmostly conserved

349Tmostly conserved

364Cmostly conserved

370Tvariable

373Avariable

382Amostly conserved

388Amostly conserved

400Cmostly conserved

403Tmostly conserved

421Tvariable

427Tmostly conserved

433Amostly conserved

442Tmostly conserved

448Tmostly conserved

466Amostly conserved

469Tvariable

475Tmostly conserved

478Tmostly conserved

482Amostly conserved

483Cmostly conserved

490Cvariable

493Amostly conserved

499Cmostly conserved

500Tvariable

506Gmostly conserved

508Tmostly conserved

517Avariable

541Tmostly conserved

557Tmostly conserved

562Tvariable

574Tvariable

583Amostly conserved

610Tmostly conserved

613Tmostly conserved

616Tmostly conserved

622Tmostly conserved

625Avariable

631Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes19

BINs12

Most divergent pair6.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Philedonides rhombicanasame genus1.8%Clepsis persicanasame family6.8%Aethes bilbaensissame family7.1%Choristoneura oraesame family7.1%Choristoneura lafauryanasame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Philedonides lunana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈372 553 623 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Philedonides lunana0.37 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.3% BUSCO

08Occurrence & distribution

Record type715 records

Wild obs. + sensor504

Museum / vouchered195

Other16

Range

Area of Occupancy AOO2 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 183≤1 km 187≤10 km 113>10 km 3

486 georeferenced · 18 without coordinates

Open the mapobservation + sensor504

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 39≤1 km 85≤10 km 29

153 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	43
NHMOlocation not on record	27
Tartu, EE	26
Provincia di Livornolocation not on record	13
SLU Artdatabankenlocation not on record	12
Salzburg, AT	8
Stockholm, SE	6
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
Rovaniemi, FI	4
CBDClocation not on record	3
South Kensington, GB	3
RMZlocation not on record	2
neflocation not on record	2
Philadelphia, US	1
NTNU-VMlocation not on record	1
Kuopio, FI	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1

18 institutions · 160 of 195 vouchered records shown · 35 without an institution code

09Environmental DNA26 detections

Where the DNA of Philedonides lunana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys4

Countries6

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map6 countries0

Hay meadowFen edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.20 °C 1.00–11.9

Seasonal swing summer↔winter20.5 °C

Max temp (day)9.80 °C 4.50–15.5

Min temp (night)1.40 °C -4.20–6.80

Precipitation54.5 mm/mo 32.4–150

Air humidity59.7 % 56.7–63.2

Moisture balance-14.1 mm/mo -27.9–49.6

Vapour deficit357 Pa 256–577

Wind speed2.40 m/s 2.10–6.00

Cloud cover49.1 % 41.3–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)