Philedone gerningana

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Philedone

At a glance

Occurrence records1 262

Data sources7

Biological traits2

DNA specimens22

eDNA detections20

Sources7 archives

Databases and archives Philedone gerningana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 262 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 262 records

Environmental DNA1 datasets · 7 countries20 detections

DNA & barcodingBOLD22 specimens

01Narrative

Philedone is a genus of moths belonging to the subfamily Tortricinae of the family Tortricidae. It contains only one species, Philedone gerningana, the cinquefoil tortrix or cinquefoil twist, which is found in Asia and Europe. It was first described by the Austrian lepidopterists Michael Denis and Ignaz Schiffermüller in 1775.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Philedone gerningana has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections20

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

23Amostly conserved

101Gvariable

235Tmostly conserved

274Cvariable

376Cvariable

437Gmostly conserved

472Tvariable

484Cmostly conserved

505Cvariable

520Amostly conserved

562Gmostly conserved

631Avariable

634Cmostly conserved

TACATTATATTTTTTATTTGGAATTTGAGCTGGATTAATTGGAACTTCTTTAAGATTATTAATTCGAATAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes14

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sparganothoides machimianasame family9.6%Archips purpuranasame family9.7%Archips crataeganasame family9.9%Adoxophyes trirhabdasame family10.3%Milionia basalissame order10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 262 records

Wild obs. + sensor859

Museum / vouchered318

Other85

Range

Area of Occupancy AOO3 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 283≤1 km 259≤10 km 238>10 km 5

785 georeferenced · 74 without coordinates

Open the mapobservation + sensor859

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 40≤1 km 168≤10 km 42>10 km 1

251 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence318

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	74
Tartu, EE	50
Salzburg, AT	36
DanishLepidopterologicalSocietylocation not on record	36
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	20
SLU Artdatabankenlocation not on record	19
NHMOlocation not on record	18
European Distributed Institute of Taxonomy (EDIT)location not on record	13
Philadelphia, US	8
Stockholm, SE	5
Rovaniemi, FI	3
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
Kuopio, FI	2
South Kensington, GB	2
CBDClocation not on record	1
Durban Natural Science Museumlocation not on record	1
Tallinn, EE	1
University of Kaiserslauternlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
neflocation not on record	1

20 institutions · 294 of 318 vouchered records shown · 24 without an institution code

09Environmental DNA20 detections

Where the DNA of Philedone gerningana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 8.60–18.6

Seasonal swing summer↔winter19.7 °C

Max temp (day)18.5 °C 13.7–22.8

Min temp (night)12.1 °C 1.90–13.8

Precipitation99.2 mm/mo 74.6–207

Air humidity60.1 % 58.2–64.4

Moisture balance-20.5 mm/mo -56.3–90.4

Vapour deficit676 Pa 405–886

Wind speed3.20 m/s 2.00–5.30

Cloud cover36.8 % 33.4–52.6

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Philedone gerningana

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 262 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 262 records