Penicillium roqueforti

Thom · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records48

Data sources11

Biological traits0

DNA specimens23

eDNA detections38

Sources11 archives

Databases and archives Penicillium roqueforti's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility48 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS64 compounds

Occurrence & distributionGBIF48 records

Environmental DNA6 datasets · 6 countries38 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceGoaT · NCBI≈29 Mbp

01Narrative

Penicillium roqueforti is a common saprotrophic fungus in the genus Penicillium. Widespread in nature, it can be isolated from soil, decaying organic matter, and plants. The major industrial use of this fungus is the production of blue cheeses, flavouring agents, antifungals, polysaccharides, proteases, and other enzymes. The fungus has been a constituent of Roquefort, Stilton, Danish blue, Cabrales, Gorgonzola, and other blue cheeses. Other blue cheeses are made with Penicillium glaucum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition64 compounds

Compounds documented for Penicillium roqueforti across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eremophilane sesquiterpenoids19

Ergot alkaloids6

Indole diketopiperazine alkaloids (L-Trp, L-Pro)6

Imidazole alkaloids $ Other indole diketopiperazine alkaloids4

Tetraketide meroterpenoids3

Documented compounds64 total

Tissue Source Quantified only

Compound	Amount	Source
(1'R,8S,8'R,10'S)-4,4,11',11',14'-pentamethylspiro[10H-[1,4]dioxepino[2,3-g]indole-8,12'-3,14-diazatetracyclo[6.5.2.01,10.03,8]pentadecane]-9,15'-dione	present	LOTUS
(1'R,8S,8'R,10'S)-4,4,11',11'-tetramethylspiro[10H-[1,4]dioxepino[2,3-g]indole-8,12'-3,14-diazatetracyclo[6.5.2.01,10.03,8]pentadecane]-9,15'-dione	present	LOTUS
(1'S,3R,8'S,10'R)-7,7,11',11'-tetramethylspiro[1H-pyrano[2,3-g]indole-3,12'-3,14-diazatetracyclo[6.5.2.01,10.03,8]pentadecane]-2,15'-dione	present	LOTUS
(1'S,8R,8'S,10'R)-4,4,11',11'-tetramethylspiro[10H-[1,4]dioxepino[2,3-g]indole-8,12'-3,14-diazatetracyclo[6.5.2.01,10.03,8]pentadecane]-9,15'-dione	present	LOTUS
(14E)-11-hydroxy-14-(1H-imidazol-5-ylmethylidene)-2-methoxy-9-(2-methylbut-3-en-2-yl)-2,13,16-triazatetracyclo[7.7.0.01,13.03,8]hexadeca-3,5,7,10-tetraene-12,15-dione	present	LOTUS
(1R,4Z,7R,9S)-4-(1H-imidazol-5-ylmethylidene)-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(1S,4R,5R,7R)-4,11,11-trimethyl-10-methylidenetricyclo[5.3.1.01,5]undecane	present	LOTUS
(1S,4R,7S,9R)-4-(1H-imidazol-5-ylmethyl)-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(1S,7S,8aR)-1,2,3,4,6,7,8,8a-Octahydro-1,8a-dimethyl-7-(1-methylethenyl)naphthalene	present	LOTUS
(3'-carbamoyl-3,3',3a-trimethyl-6-oxospiro[2,3,4,7b-tetrahydro-1aH-naphtho[1,2-b]oxirene-5,2'-oxirane]-2-yl) acetate	present	LOTUS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium roqueforti has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes2

GenBank sequences10

eDNA detections38

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMH860759.1 ↗548 bpUSSR

ACGT

TCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTACCTTATTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCG …

Penicillium roqueforti strain CBS 498.73 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Penicillium camembertisame genus3.3%Penicillium communesame genus3.3%Penicillium palitanssame genus3.3%Penicillium tricolorsame genus3.3%Penicillium glandicolasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027416 ↗ · 19 protein · 27 tRNA · 1 rRNA

nad2nad5nad4Lorf285cox2nad3atp9orf372cox1orf316rps3cox3nad6atp6orf239atp8nad4nad1cobrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium roqueforti carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈28 754 521 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium roqueforti0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type48 records

Wild obs. + sensor13

Museum / vouchered29

Cultivated / captive6

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 2≤1 km 1≤10 km 8>10 km 1

12 georeferenced · 1 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	4
BDBClocation not on record	1
Lincoln, US	1
National Institute of Biological Resourceslocation not on record	1

4 institutions · 7 of 29 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA38 detections

Where the DNA of Penicillium roqueforti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys6

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map6 countries0

Neotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 6.10–19.9

Seasonal swing summer↔winter15.3 °C

Max temp (day)16.9 °C 9.10–23.6

Min temp (night)11.7 °C 3.10–16.4

Precipitation85.7 mm/mo 55.5–267

Air humidity66.0 % 58.6–67.1

Moisture balance29.3 mm/mo -43.0–152

Vapour deficit588 Pa 353–826

Wind speed3.10 m/s 1.60–4.00

Cloud cover40.3 % 33.2–52.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)