Penicillium commune

Thom · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Eurotiales/Aspergillaceae/Penicillium

At a glance

Occurrence records60

Data sources13

Biological traits0

DNA specimens47

eDNA detections43

Sources13 archives

Databases and archives Penicillium commune's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

OBISOcean Biodiversity Information System21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS66 compounds

Occurrence & distributionGBIF · OBIS60 records

Environmental DNA5 datasets · 3 countries43 detections

DNA & barcodingBOLD · NCBI47 specimens

Genome at a glanceGoaT · NCBI≈37 Mbp

01Narrative

Penicillium commune is an indoor fungus belonging to the genus Penicillium. It is known as one of the most common fungi spoilage moulds on cheese. It also grows on and spoils other foods such as meat products and fat-containing products like nuts and margarine. Cyclopiazonic acid and regulovasine A and B are the most important mycotoxins produced by P. commune. The fungus is the only known species to be able to produce both penitrem A and roquefortine. Although this species does not produce penicillin, it has shown to have anti-pathogenic activity. There are no known plant, animal or human diseases caused by P. commune.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition66 compounds

Compounds documented for Penicillium commune across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Azaphilones17

Cyclopiazonic acid-tpye tetramate alkaloids9

Isocoumarins9

Imidazole alkaloids6

Ergostane steroids5

Documented compounds66 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Penicilliumine	present	LOTUS
(-)-Fumigaclavine B	present	LOTUS
(1R,4Z,7R,9S)-4-(1H-imidazol-5-ylmethylidene)-9-(2-methylbut-3-en-2-yl)-2,5,16-triazatetracyclo[7.7.0.02,7.010,15]hexadeca-10,12,14-triene-3,6-dione	present	LOTUS
(22E,24R)-ergosta-5alpha,6alpha-epoxide-8,22-diene-3beta,7alpha-diol	present	LOTUS
(22E,24R)-ergosta-7,22-diene-3,6-dione	present	LOTUS
(7,9-dimethyl-6,6a,8,9,10,10a-hexahydro-4H-indolo[4,3-fg]quinolin-10-yl) acetate	present	LOTUS
1-o-(2,4-Dihydroxy-6-methylbenzoyl)-glycerol	present	LOTUS
17-(5,6-Dimethylhept-3-en-2-yl)-10,13-dimethyl-1,2,3,4,6,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthrene-3,5,6-triol	present	LOTUS
17-(5,6-Dimethylhept-3-En-2-Yl)-10,13-Dimethyl-2,3,4,9,11,12,14,15,16,17-Decahydro-1H-Cyclopenta(A)Phenanthren-3-Ol	present	LOTUS
2-hydroxy-N-[3-hydroxy-9-methyl-1-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyicosa-4,8-dien-2-yl]hexadec-3-enamide	present	LOTUS

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Penicillium commune has left across the world's sequence archives.

At a glance

DNA specimens47

Marker genes5

GenBank sequences10

eDNA detections43

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPZ135044.1 ↗406 bpPoland · 2022

ACGT

CGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGA …

Penicillium commune isolate UWR_1114 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Penicillium commune carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈36 635 272 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Penicillium commune0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type60 records

Wild obs. + sensor1

Museum / vouchered56

Cultivated / captive3

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence56

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
National Institute of Biological Resourceslocation not on record	1
Scientific Institute of Public Health, Brusselslocation not on record	1

2 institutions · 2 of 56 vouchered records shown · 33 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA43 detections

Where the DNA of Penicillium commune was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys5

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.4 °C 10.9–16.3

Seasonal swing summer↔winter23.0 °C

Max temp (day)15.6 °C 14.3–21.0

Min temp (night)9.20 °C 6.60–11.3

Precipitation77.0 mm/mo 75.2–106

Air humidity59.5 % 57.9–63.2

Moisture balance30.4 mm/mo -34.2–31.0

Vapour deficit626 Pa 511–775

Wind speed2.90 m/s 2.90–3.40

Cloud cover47.5 % 26.1–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)