Paralvinella sulfincola

Desbruyères & Laubier, 1993 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Alvinellidae/Paralvinella

At a glance

Occurrence records125

Data sources8

Biological traits4

DNA specimens12

eDNA detections15

Sources8 archives

Databases and archives Paralvinella sulfincola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

OBISOcean Biodiversity Information System52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS125 records

Environmental DNA2 datasets · 4 countries15 detections

DNA & barcodingBOLD12 specimens

01Narrative

Paralvinella sulfincola, also known as the sulfide worm, is a species of polychaete worm of the Alvinellidae family that thrives on undersea hot-water vents. It dwells within tubes in waters surrounding hydrothermal vents, in close proximity to super-heated fluids reaching over 300 °C. The upper thermal limit for this polychaete is unknown; however, it is unlikely they can survive in constant temperatures over 50 °C. It may tentatively be named a metazoan extremophile or, more specifically, a thermophile. Their unique abilities to withstand high temperatures close to hydrothermal fluids enables them to prey upon sulphur-oxidising bacterial mats which grow close to the metal rich vent plume.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max2 400 m

Depth min1 530 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paralvinella sulfincola has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections15

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

43Cmostly conserved

52Tmostly conserved

70Amostly conserved

127Tmostly conserved

142Tmostly conserved

184Amostly conserved

247Cmostly conserved

268Tmostly conserved

512Gmostly conserved

583Gmostly conserved

631Amostly conserved

AACACTATACTTCCTATTTGGTGTCTGAGCAGGTCTTTTAGGCGTATCTACTAGACTTATTATGCGAACAGAACTTGGACAACCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes4

BIN1

Most divergent pair0.61%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paralvinella palmiformissame genus12.8%Alvinella caudatasame family15.3%Alvinella pompejanasame family15.8%Paralvinella fijiensissame genus16.0%Paralvinella grassleisame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type125 records

Museum / vouchered101

Other24

Range

Area of Occupancy AOO100 km²

Depth

0–200 m sunlit3

200–1000 m twilight0

1–4 km midnight43

>4 km abyssal0

median 2 200 m · max 2 697 m · 46 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 11≤1 km 19>10 km 6

36 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence101

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	25
Chicago, US	23
Victoria, CA	4
ARMS-MBONlocation not on record	3
Montgomery, US	3
Santa Barbara Museum of Natural Historylocation not on record	1
WoRMS Editorial Boardlocation not on record	1

7 institutions · 60 of 101 vouchered records shown · 1 without an institution code

09Environmental DNA15 detections

Where the DNA of Paralvinella sulfincola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys2

Countries4

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

Marina/Harbour; semi-industrial; 9.6 - Subti…Marine Protected Area; protected; 9.2 - Subt…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.8–15.9

Seasonal swing summer↔winter8.00 °C

Max temp (day)16.1 °C 14.2–17.0

Min temp (night)15.1 °C 11.6–15.1

Precipitation45.5 mm/mo 45.5–82.0

Air humidity67.0 % 61.8–67.0

Vapour deficit581 Pa 554–608

Cloud cover54.1 % 45.0–60.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)