Alvinella pompejana

Desbruyères & Laubier, 1980 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Alvinellidae/Alvinella

At a glance

Occurrence records384

Data sources9

Biological traits2

DNA specimens381

eDNA detections381

Sources9 archives

Databases and archives Alvinella pompejana's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility175 records↗

OBISOcean Biodiversity Information System209 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI381 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics381 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.73 Gbp↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS384 records

Environmental DNA1 datasets · 4 countries381 detections

DNA & barcodingBOLD381 specimens

Genome at a glanceGoaT729 Mbp

01Narrative

Alvinella pompejana, the Pompeii worm, is a species of deep-sea polychaete worm (commonly referred to as "bristle worms"). It is an extremophile found only at hydrothermal vents in the Pacific Ocean, discovered in the early 1980s off the Galápagos Islands by French marine biologists.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding381 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alvinella pompejana has left across the world's sequence archives.

At a glance

DNA specimens381

BINs1

Marker genes2

eDNA detections381

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P507 bp consensus379 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

1Gmostly conserved

2Amostly conserved

11Gvariable

77Tmostly conserved

119Cmostly conserved

227Tvariable

239Tmostly conserved

254Tmostly conserved

320Gvariable

362Gmostly conserved

368Gmostly conserved

470Cvariable

GAGATGATCAGCTATACAACACAATCATTACAGCCCACGGTCTTCTAATGCTATTCTTCTTCGTAACACCTATCTTTATAGGAGGTTTCG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 62 variants.

Diversity (π)0.99%

Haplotypes62

BIN1

Most divergent pair2.6%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alvinella caudatasame genus11.6%Paralvinella grassleisame family12.6%Paralvinella palmiformissame family13.6%Paralvinella sulfincolasame family15.8%Paralvinella fijiensissame family16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Alvinella pompejana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size728 610 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Alvinella pompejana0.73 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type384 records

Wild obs. + sensor190

Museum / vouchered168

Other26

Range

Area of Occupancy AOO164 km²

Depth

0–200 m sunlit0

200–1000 m twilight0

1–4 km midnight179

>4 km abyssal0

median 2 622 m · max 2 839 m · 179 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 162

162 georeferenced · 28 without coordinates

Open the mapobservation + sensor190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	128
Chicago, US	12
Cambridge, US	3
Puerto Ayora, EC	2
WoRMS Editorial Boardlocation not on record	1
Copenhagen, DK	1

6 institutions · 147 of 168 vouchered records shown · 15 without an institution code

09Environmental DNA381 detections

Where the DNA of Alvinella pompejana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found381

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 381 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 23.5–28.2

Seasonal swing summer↔winter5.50 °C

Max temp (day)26.7 °C 24.2–30.7

Min temp (night)25.3 °C 22.9–26.1

Precipitation131 mm/mo 44.3–171

Air humidity64.3 % 59.5–64.7

Vapour deficit1,214 Pa 1,044–1,548

Cloud cover48.4 % 25.0–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 339 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)