Paracoccus marginatus

Williams & Granara de Willink, 1992 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pseudococcidae/Paracoccus

At a glance

Occurrence records94

Data sources8

Biological traits0

DNA specimens278

eDNA detections250

Sources8 archives

Databases and archives Paracoccus marginatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility94 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI250 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics278 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF94 records

Environmental DNA1 datasets · 10 countries250 detections

DNA & barcodingBOLD278 specimens

Genome at a glanceGoaT · NCBI≈214 Mbp

01Narrative

Paracoccus marginatus, commonly known as the papaya mealybug, is a small sap-sucking insect in the mealybug family, Pseudococcidae. It is found on a number of different hosts, including economically important tropical fruit trees and various ornamental plants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding278 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracoccus marginatus has left across the world's sequence archives.

At a glance

DNA specimens278

BINs1

Marker genes4

eDNA detections250

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus216 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

ATTTTTGGATTTTGATCAAGATTAATAGGTTTATCAATAAGTTTTATTATTCGAATTGAATTAATAAATTTAAATAATAATTTTAATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.02%

Haplotypes4

BIN1

Most divergent pair0.63%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atrococcus paludinussame family5.5%Paracoccus burneraesame genus6.0%Pseudococcus comstockisame family6.1%Spilococcus mamillariaesame family6.1%Pseudococcus odermattisame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

06Genome at a glanceGoaT · NCBI

The complete instruction manual Paracoccus marginatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈214 161 890 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Paracoccus marginatus0.21 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness87% BUSCO

08Occurrence & distribution

Record type94 records

Wild obs. + sensor37

Museum / vouchered43

Other14

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 8≤1 km 3≤10 km 7>10 km 15

33 georeferenced · 4 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Centre for Biodiversity Genomicslocation not on record	1
Guangdong Inspection and Quarantine Technology Centerlocation not on record	1
Kerala Agricultural Universitylocation not on record	1

3 institutions · 3 of 43 vouchered records shown · 34 without an institution code

09Environmental DNA250 detections

Where the DNA of Paracoccus marginatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found250

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 250 detections have coordinates

Open the map10 countries0

3. Shrubland|3.5. Subtropical/Tropical Dry S…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.6. Subtropical/Trop…Mango

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 10.0–28.6

Seasonal swing summer↔winter14.7 °C

Max temp (day)28.7 °C 15.7–31.7

Min temp (night)19.2 °C 3.10–25.4

Precipitation59.9 mm/mo 13.7–293

Air humidity58.2 % 44.8–67.2

Moisture balance-42.3 mm/mo -165–134

Vapour deficit1,298 Pa 827–1,580

Wind speed2.60 m/s 1.20–4.90

Cloud cover33.7 % 16.4–54.3

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)