Pseudococcus comstocki

(Kuwana, 1902) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Pseudococcidae/Pseudococcus

At a glance

Occurrence records66

Data sources11

Biological traits0

DNA specimens74

eDNA detections69

Sources11 archives

Databases and archives Pseudococcus comstocki's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility66 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics74 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS2 compounds

Occurrence & distributionGBIF66 records

Environmental DNA1 datasets · 5 countries69 detections

DNA & barcodingBOLD74 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Pseudococcus comstocki, common name Comstock mealybug, is a species of mealybug. The species was first discovered in 1902 in Japan. It is an invasive pest species that feeds on fruit and plants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Pseudococcus comstocki across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Wax monoesters1

Gallotannins1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Dimethyl tetradecanedioate		present	LOTUS
Ellagic acid		present	NPASS

05DNA & barcoding74 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pseudococcus comstocki has left across the world's sequence archives.

At a glance

DNA specimens74

BINs3

Marker genes4

eDNA detections69

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P649 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

2Tmostly conserved

14Tmostly conserved

19Tmostly conserved

22Tmostly conserved

34Amostly conserved

46Tmostly conserved

103Tmostly conserved

208Amostly conserved

235Tmostly conserved

340Tmostly conserved

346Amostly conserved

466Tmostly conserved

484Cvariable

486Tvariable

490Tmostly conserved

505Tvariable

538Tmostly conserved

545Amostly conserved

604Tmostly conserved

622Amostly conserved

637Tmostly conserved

ATTAATATATTTATTATTTGGTTTTTGATCAGGATTAATAGGTCTTTCAATAAGATTTATTATTCGAATTGAATTAATAAATTTAAATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes11

BINs3

Most divergent pair8.9%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudococcus odermattisame genus1.5%Pseudococcus cryptussame genus4.6%Atrococcus paludinussame family6.0%Nipaecoccus bromelicolasame family6.5%Paracoccus burneraesame family6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Pseudococcus comstocki carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 102×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type66 records

Wild obs. + sensor2

Museum / vouchered64

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 8≤1 km 1≤10 km 2

11 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	32
National Plant Quarantine Service, South Korealocation not on record	1
Guangdong Inspection and Quarantine Technology Centerlocation not on record	1
Catholic University of Pekinglocation not on record	1
Essig Museum of Entomologylocation not on record	1

5 institutions · 36 of 64 vouchered records shown · 24 without an institution code

09Environmental DNA69 detections

Where the DNA of Pseudococcus comstocki was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found69

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 69 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C -6.80–23.0

Seasonal swing summer↔winter25.4 °C

Max temp (day)19.4 °C -0.8–26.4

Min temp (night)12.2 °C -12.8–18.8

Precipitation51.5 mm/mo 1.60–295

Air humidity57.7 % 45.7–64.9

Moisture balance-28.2 mm/mo -95.2–174

Vapour deficit827 Pa 190–1,029

Wind speed2.80 m/s 2.30–4.50

Cloud cover29.8 % 17.2–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)