Parachromis friedrichsthalii

(Heckel, 1840) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Parachromis

At a glance

Occurrence records783

Data sources10

Biological traits6

DNA specimens30

eDNA detections22

Sources10 archives

Databases and archives Parachromis friedrichsthalii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility555 records↗

OBISOcean Biodiversity Information System228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS783 records

Environmental DNA1 datasets · 3 countries22 detections

DNA & barcodingBOLD30 specimens

01Narrative

Parachromis friedrichsthalii, the Yellowjacket cichlid, is a species of cichlid native to Central America where it is found along the Atlantic Slope in Mexico, Belize, Honduras and Guatemala. This species grows to a length of 28 cm SL. This species is popular with anglers as a gamefish and can also be found in the aquarium trade. The specific name honours the Austrian explorer, botanist and archaeologist Emanuel von Friedrichsthal (1809-1842), who sent many specimens to Vienna from Central America, including the type of this fish. P. friedrichsthalii has an unusual hunting mechanism. The species has been observed to lie immobile near the bottom, feigning death. When smaller fish approach and attempt to pick at the dead fish, P. friedrichsthalii ambush the smaller fish. Similar behaviour has also been observed in some species of Lake Malawi cichlids, particularly from the genus Nimbochromis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length28 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability24.16

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parachromis friedrichsthalii has left across the world's sequence archives.

At a glance

DNA specimens30

BINs3

Marker genes1

eDNA detections22

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

25Amostly conserved

40Cmostly conserved

55Amostly conserved

56Cmostly conserved

58Amostly conserved

82Amostly conserved

106Amostly conserved

124Amostly conserved

160Tmostly conserved

169Cmostly conserved

181Cmostly conserved

184Tvariable

194Tmostly conserved

196Gmostly conserved

199Cmostly conserved

202Gvariable

253Cmostly conserved

265Tmostly conserved

268Cmostly conserved

277Tmostly conserved

280Tvariable

298Tmostly conserved

325Amostly conserved

340Cmostly conserved

356Tmostly conserved

358Amostly conserved

364Cmostly conserved

370Cmostly conserved

394Tmostly conserved

418Gmostly conserved

421Tmostly conserved

439Cmostly conserved

451Gmostly conserved

487Tmostly conserved

493Amostly conserved

497Tmostly conserved

539Cmostly conserved

589Amostly conserved

616Gmostly conserved

622Amostly conserved

628Amostly conserved

630Amostly conserved

650Tmostly conserved

CCTTTACCTAGTTTTTGGTGCTTGAGCCGGAATAGTAGGCACCGCATTAAGCCTACTAATCCGAGCAGAACTCAGCCAACCAGGCTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes5

BINs3

Most divergent pair6.3%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parachromis loiselleisame genus1.9%Parachromis doviisame genus5.1%Amatitlania septemfasciatasame family5.1%Amphilophus citrinellussame family5.6%Amphilophus amarillosame family5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

07Deep time~4.96 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.96 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type783 records

Wild obs. + sensor93

Museum / vouchered690

Origin

Native32

Range

Area of Occupancy AOO1 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 28≤1 km 14≤10 km 41>10 km 4

87 georeferenced · 6 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 167≤1 km 32≤10 km 122>10 km 6

327 georeferenced · 363 without coordinates

Open the institutions mapphysical evidence690

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tapachula, MX	187
Ann Arbor, US	71
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	47
FishBaselocation not on record	21
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	20
Mexico City, MX	17
Los Angeles, US	16
Universidad de Antioquia (UdeA)location not on record	14
Louisiana State University, Museum of Zoologylocation not on record	10
Chicago, US	10
Morelia, MX	7
Texas Cooperative Wildlife Collectionlocation not on record	6
Universidad del Valle de Guatemalalocation not on record	4
Southeastern Louisiana University, Vertebrate Museumlocation not on record	4
Juriquilla, MX	3
Toronto, CA	2
Cambridge, US	1
Stockholm, SE	1
Mexico City, MX	1
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1
	1

21 institutions · 444 of 690 vouchered records shown · 20 without an institution code

09Environmental DNA22 detections

Where the DNA of Parachromis friedrichsthalii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 21.0–27.6

Seasonal swing summer↔winter5.00 °C

Max temp (day)29.5 °C 25.6–31.0

Min temp (night)20.5 °C 16.5–24.2

Precipitation99.2 mm/mo 69.4–163

Air humidity63.9 % 62.9–65.6

Moisture balance-38.1 mm/mo -48.8–1.10

Vapour deficit1,129 Pa 891–1,268

Wind speed1.90 m/s 1.80–2.20

Cloud cover21.1 % 17.9–28.7

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)