Amphilophus amarillo

Stauffer & McKaye, 2002 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Amphilophus

At a glance

Occurrence records31

Data sources7

Biological traits6

DNA specimens3

eDNA detections7

Sources7 archives

Databases and archives Amphilophus amarillo's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD3 specimens

01Narrative

Amphilophus amarillo est une espèce de poissons néotropicaux.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15.5 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits3

Depth max10 m

Depth min3 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphilophus amarillo has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTTTACCTAATTTTTGGTGCTTGGGCCGGAATGGTAGGCACCGCATTAAGCCTATTAATCCGAGCAGAACTCAGCCAACCAGGCTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parachromis loiselleisame family4.8%Parachromis friedrichsthaliisame family5.7%Parachromis managuensissame family5.9%Parachromis doviisame family5.9%Amatitlania septemfasciatasame family6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type31 records

Wild obs. + sensor4

Museum / vouchered27

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ARMS-MBONlocation not on record	7
ZSMlocation not on record	2
FishBaselocation not on record	1

3 institutions · 10 of 27 vouchered records shown · 17 without an institution code

09Environmental DNA7 detections

Where the DNA of Amphilophus amarillo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Verifiable raw sequence linked7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

Marina; semi-industrial; 9.6 - Subtidal MuddyLong-Term Ecological Research Site; LHI (Low…Research site; semi-industrial; 9.5 - Subtid…Long-Term Ecological Research Site; LHI (Low…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 11.7–25.2

Seasonal swing summer↔winter16.7 °C

Max temp (day)31.2 °C 13.5–31.2

Min temp (night)18.7 °C 8.90–20.1

Precipitation1.80 mm/mo 1.80–78.7

Air humidity50.0 % 50.0–64.4

Moisture balance-163 mm/mo -163–-34.5

Vapour deficit1,610 Pa 510–1,610

Wind speed5.10 m/s 2.70–5.10

Cloud cover11.8 % 11.8–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)