Paracentropyge multifasciata

(Smith & Radcliffe, 1911) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pomacanthidae/Paracentropyge

At a glance

Occurrence records250

Data sources9

Biological traits7

DNA specimens20

eDNA detections12

Sources9 archives

Databases and archives Paracentropyge multifasciata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

OBISOcean Biodiversity Information System125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS250 records

Environmental DNA1 datasets · 3 countries12 detections

DNA & barcodingBOLD20 specimens

01Narrative

Paracentropyge multifasciata, the barred angelfish, banded pygmy-angelfish, many-banded angelfish, multi-banded angelfish or multibarred angelfish, is a species of marine ray-finned fish, a marine angelfish, belonging to the family Pomacanthidae. It is native to the Indo-Pacific.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max100 m

Depth min7 m

Vulnerability10

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Paracentropyge multifasciata has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes11

eDNA detections12

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

224Cmostly conserved

230Tvariable

233Cvariable

293Amostly conserved

407Cmostly conserved

503Tmostly conserved

509Cmostly conserved

608Gvariable

GGACAGCTTTAAGCCTACTAATTCGAGCGGAACTTAACCAACCAGGCAGCCTCCTTGGAGATGACCAAATCTACAATGTTATCGTTACAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes7

BIN1

Most divergent pair1.1%

OceaniaOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Centropyge venustasame family8.0%Apolemichthys trimaculatussame family10.7%Apolemichthys armitageisame family10.7%Apolemichthys griffisisame family11.2%Apolemichthys xanthurussame family11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

08Occurrence & distribution

Record type250 records

Wild obs. + sensor127

Museum / vouchered123

Range

Area of Occupancy AOO456 km²

Depth

0–200 m sunlit68

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21.2 m · max 46 m · 68 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 84≤1 km 11≤10 km 2>10 km 3

100 georeferenced · 27 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 6≤1 km 11≤10 km 7>10 km 13

37 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	19
Washington, US	16
No Voucherlocation not on record	7
Western Australian Museumlocation not on record	6
Chicago, US	5
Chiba, JP	2
Unknownlocation not on record	2
Cambridge, US	1
University of California San Diegolocation not on record	1
	1

10 institutions · 60 of 123 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Paracentropyge multifasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 23.7–26.5

Seasonal swing summer↔winter2.20 °C

Max temp (day)26.5 °C 24.2–27.8

Min temp (night)24.5 °C 23.1–25.4

Precipitation163 mm/mo 82.3–187

Air humidity67.6 % 60.9–68.6

Moisture balance-15.9 mm/mo

Vapour deficit1,135 Pa 915–1,313

Wind speed4.10 m/s

Cloud cover17.9 % 17.5–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)