Apolemichthys griffisi

(Carlson & Taylor, 1981) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Pomacanthidae/Apolemichthys

At a glance

Occurrence records290

Data sources10

Biological traits6

DNA specimens13

eDNA detections3

Sources10 archives

Databases and archives Apolemichthys griffisi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility147 records↗

OBISOcean Biodiversity Information System143 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS290 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD13 specimens

01Narrative

Apolemichthys griffisi, or Griffis angelfish, is a species of ray-finned fish, a marine angelfish belonging to the family Pomacanthidae. It is found in the Pacific Ocean. It is a rarity for the species to enter the aquarium trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length30 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max110 m

Depth min10 m

Vulnerability20

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apolemichthys griffisi has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes11

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCTCTATTTGTTATTCGGTGCTTGAGCTGGGATAGTAGGAACAGCTTTAAGCCTACTAATCCGAGCGGAACTAAATCAGCCAGGCAGCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apolemichthys xanthurussame genus6.6%Apolemichthys trimaculatussame genus7.1%Apolemichthys armitageisame genus7.1%Apolemichthys xanthotissame genus7.8%Apolemichthys kingisame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027592 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type290 records

Wild obs. + sensor288

Museum / vouchered2

Range

Area of Occupancy AOO124 km²

Depth

0–200 m sunlit141

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 21 m · max 27 m · 141 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 236≤1 km 39≤10 km 4>10 km 9

288 georeferenced

Open the mapobservation + sensor288

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA3 detections

Where the DNA of Apolemichthys griffisi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)