Ornithomya fringillina

(Curtis, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Hippoboscidae/Ornithomya

At a glance

Occurrence records488

Data sources9

Biological traits0

DNA specimens48

eDNA detections45

Sources9 archives

Databases and archives Ornithomya fringillina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF488 records

Environmental DNA1 datasets · 7 countries45 detections

DNA & barcodingBOLD48 specimens

Genome at a glanceGoaT · NCBI≈173 Mbp

01Narrative

Ornithomya fringillina is a species of fly in the family Hippoboscidae. It is found in the Palearctic .Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi. Hutson, A.M. 1984. Keds, flat-flies and bat-flies. Diptera, Hippoboscidae and Nycteribiidae. Handbooks for the Identification of British Insects 10(7): 1-40. Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithomya fringillina has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes2

eDNA detections45

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

79Tmostly conserved

94Gmostly conserved

250Cmostly conserved

271Cmostly conserved

283Amostly conserved

284Cmostly conserved

298Tmostly conserved

382Gmostly conserved

400Tmostly conserved

424Cmostly conserved

433Amostly conserved

448Tmostly conserved

472Tmostly conserved

500Cmostly conserved

547Cmostly conserved

578Tmostly conserved

619Cvariable

641Cmostly conserved

AACTCTATATTTTATTTTTGGAGCATGATCTGGAATAATTGGAACTTCTTTAAGAATCTTAATTCGAGCTGAATTAGGTCACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes5

BINs2

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ornithomya bequaertisame genus2.4%Crataerina hirundinissame family6.1%Ornithomya bilobasame genus7.1%Ornithomya aviculariasame genus7.1%Ornithomya chloropussame genus7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ornithomya fringillina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈172 795 544 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ornithomya fringillina0.17 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.2% BUSCO

08Occurrence & distribution

Record type488 records

Wild obs. + sensor336

Museum / vouchered152

Range

Area of Occupancy AOO640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 48≤1 km 182≤10 km 78>10 km 2

310 georeferenced · 26 without coordinates

Open the mapobservation + sensor336

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 13≤1 km 53≤10 km 27>10 km 2

95 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence152

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	48
Helsinki, FI	20
San Francisco, US	13
SLU Artdatabankenlocation not on record	11
University of Tokyo, Department of Zoologylocation not on record	10
BioFokuslocation not on record	8
Gothenburg, SE	6
University of Wisconsin-Stevens Pointlocation not on record	5
South Kensington, GB	4
Cambridge, US	3
CBDClocation not on record	3
Tilburg, NL	2
Natural History Museum, Londonlocation not on record	2
Station Linnelocation not on record	1
Royal British Columbia Museumlocation not on record	1
Chicago, US	1

16 institutions · 138 of 152 vouchered records shown · 6 without an institution code

09Environmental DNA45 detections

Where the DNA of Ornithomya fringillina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map7 countries0

On various birds

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.50 °C 8.30–17.5

Seasonal swing summer↔winter19.0 °C

Max temp (day)11.9 °C 10.8–21.6

Min temp (night)6.50 °C 4.40–13.0

Precipitation68.2 mm/mo 50.2–113

Air humidity62.3 % 60.2–65.3

Moisture balance-6.30 mm/mo -28.3–31.3

Vapour deficit471 Pa 386–796

Wind speed3.40 m/s 2.60–3.90

Cloud cover41.7 % 35.7–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)