Ornithomya avicularia

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Hippoboscidae/Ornithomya

At a glance

Occurrence records1 050

Data sources9

Biological traits0

DNA specimens154

eDNA detections104

Sources9 archives

Databases and archives Ornithomya avicularia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 050 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI104 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 050 records

Environmental DNA2 datasets · 8 countries104 detections

DNA & barcodingBOLD154 specimens

Genome at a glanceGoaT · NCBI≈161 Mbp

01Narrative

Ornithomya avicularia is a species of fly in the family Hippoboscidae. It is found in the Palearctic.Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I,II. Amerind Publishing Co., New Delhi. Hutson, A.M. 1984. Keds, flat-flies and bat-flies. Diptera, Hippoboscidae and Nycteribiidae. Handbooks for the Identification of British Insects 10(7): 1-40. Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ornithomya avicularia has left across the world's sequence archives.

At a glance

DNA specimens154

BINs2

Marker genes2

eDNA detections104

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus134 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

1Amostly conserved

22Gvariable

40Tmostly conserved

43Avariable

46Cvariable

70Tvariable

82Tvariable

100Gvariable

142Cvariable

151Tmostly conserved

316Avariable

412Amostly conserved

427Cvariable

433Gvariable

463Tvariable

466Amostly conserved

472Amostly conserved

511Avariable

523Tvariable

533Tvariable

589Tvariable

595Tvariable

598Avariable

619Tmostly conserved

622Tvariable

628Gvariable

AACTTTATATTTTATTTTTGGGGCCTGATCTGGAATAATTGGAACCTCTTTAAGAATTTTAATTCGTGCTGAATTAGGTCATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.

Diversity (π)1.7%

Haplotypes44

BINs2

Most divergent pair4.0%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ornithomya bequaertisame genus6.7%Ornithomya fringillinasame genus7.1%Ornithomya aobatonissame genus7.4%Ornithomya chloropussame genus7.9%Ornithomya bilobasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ornithomya avicularia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈161 152 450 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ornithomya avicularia0.16 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness96.6% BUSCO

08Occurrence & distribution

Record type1 050 records

Wild obs. + sensor740

Museum / vouchered309

Fossil1

Range

Area of Occupancy AOO2 600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 340≤1 km 172≤10 km 183>10 km 8

703 georeferenced · 37 without coordinates

Open the mapobservation + sensor740

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 58≤1 km 52≤10 km 52>10 km 6

168 georeferenced · 141 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	48
Helsinki, FI	33
CBDClocation not on record	30
SLU Artdatabankenlocation not on record	27
Gothenburg, SE	27
BioFokuslocation not on record	22
University of Tokyo, Department of Zoologylocation not on record	18
Tilburg, NL	6
NHMOlocation not on record	6
Cambridge, US	5
Philadelphia, US	5
ZMAAlocation not on record	4
Chiba, JP	4
South Kensington, GB	4
neflocation not on record	2
KwaZulu-Natal Museumlocation not on record	2
San Francisco, US	1
Bavarian State Collection of Zoologylocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Natural History Museum, Londonlocation not on record	1
ZSM Collection of Manfred Sommererlocation not on record	1
Ugentlocation not on record	1
Harold Winfred Manter Laboratory of Parasitologylocation not on record	1
DFFW2018location not on record	1

24 institutions · 251 of 309 vouchered records shown · 43 without an institution code

09Environmental DNA104 detections

Where the DNA of Ornithomya avicularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found104

Studies independent surveys2

Countries8

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 104 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C -1.10–18.1

Seasonal swing summer↔winter19.4 °C

Max temp (day)16.9 °C 1.10–22.4

Min temp (night)10.4 °C -3.80–15.2

Precipitation64.3 mm/mo 29.3–105

Air humidity61.7 % 58.5–67.6

Moisture balance-9.50 mm/mo -51.3–13.9

Vapour deficit627 Pa 189–867

Wind speed3.50 m/s 2.90–5.10

Cloud cover41.7 % 32.4–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ornithomya avicularia

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 050 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 050 records