Ophiusa parcemacula

Lucas, 1891 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Ophiusa

At a glance

Occurrence records228

Data sources7

Biological traits0

DNA specimens47

eDNA detections43

Sources7 archives

Databases and archives Ophiusa parcemacula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 1 countries43 detections

DNA & barcodingBOLD47 specimens

01Narrative

Ophiusa parcemacula is a moth of the family Erebidae. It is found in New Guinea, New Caledonia and the northern half of Australia. The wingspan is about 60 mm. The larvae feed on Loranthaceae and Melaleuca quinquenervia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ophiusa parcemacula has left across the world's sequence archives.

At a glance

DNA specimens47

BINs2

Marker genes2

eDNA detections43

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.57%

Haplotypes2

BINs2

Most divergent pair11.9%

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ophiusa tirhacasame genus2.4%Ophiusa costiplagasame genus3.2%Ophiusa dianarissame genus3.5%Ophiusa disjungenssame genus3.6%Clytie terrulentasame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type228 records

Wild obs. + sensor175

Museum / vouchered53

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 57≤1 km 43≤10 km 13>10 km 9

122 georeferenced · 53 without coordinates

Open the mapobservation + sensor175

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 2≤10 km 3>10 km 2

7 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	26
ZSMlocation not on record	6
DPIlocation not on record	6
Western Australian Museumlocation not on record	2
Sydney, AU	2
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Research Collection of Egbert Friedrichlocation not on record	1
Natick, US	1
Cornell University Insect Collectionlocation not on record	1
Australian National Fish Collectionlocation not on record	1

10 institutions · 48 of 53 vouchered records shown · 5 without an institution code

09Environmental DNA43 detections

Where the DNA of Ophiusa parcemacula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 19.8–29.8

Seasonal swing summer↔winter11.3 °C

Max temp (day)25.5 °C 23.9–35.2

Min temp (night)16.5 °C 14.1–23.6

Precipitation80.0 mm/mo 21.1–142

Air humidity58.2 % 46.5–62.6

Moisture balance-70.1 mm/mo -140–-15.6

Vapour deficit1,224 Pa 908–2,085

Wind speed2.90 m/s 2.20–4.90

Cloud cover30.2 % 20.0–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)