Ophiusa disjungens

(Walker, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Ophiusa

At a glance

Occurrence records983

Data sources6

Biological traits0

DNA specimens94

eDNA detections87

Sources6 archives

Databases and archives Ophiusa disjungens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility983 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI87 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics94 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF983 records

Environmental DNA1 datasets · 7 countries87 detections

DNA & barcodingBOLD94 specimens

01Narrative

Ophiusa disjungens, the guava moth, is a moth of the family Erebidae. The species was first described by Francis Walker in 1858. It is found in south-east Asia and the south Pacific, including Thailand, Japan, Tonga and New South Wales and Queensland. The adult is a fruit piercer.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding94 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ophiusa disjungens has left across the world's sequence archives.

At a glance

DNA specimens94

BINs2

Marker genes2

eDNA detections87

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

316Amostly conserved

347Tmostly conserved

361Cmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes15

BINs2

Most divergent pair1.1%

OceaniaN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ophiusa tirhacasame genus3.3%Ophiusa dianarissame genus3.5%Ophiusa parcemaculasame genus3.6%Minucia lunarissame family4.1%Ophiusa umbrilineasame genus4.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type983 records

Wild obs. + sensor899

Museum / vouchered84

Origin

Native3

Range

Area of Occupancy AOO1 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 413≤1 km 267≤10 km 28>10 km 64

772 georeferenced · 127 without coordinates

Open the mapobservation + sensor899

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 2

10 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	25
Taiwan Forestry Research Institutelocation not on record	24
Helsinki, FI	10
DPIlocation not on record	6
New Haven, US	3
SUVlocation not on record	3
Natick, US	3
Cornell University Insect Collectionlocation not on record	3
Tallinn, EE	1
USGS Pacific Island Ecosystems Research Centerlocation not on record	1
ZSMlocation not on record	1

11 institutions · 80 of 84 vouchered records shown · 4 without an institution code

09Environmental DNA87 detections

Where the DNA of Ophiusa disjungens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found87

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 87 detections have coordinates

Open the map7 countries0

Dry Sclerophyll ForestWestern GhatsMixed Introduced ForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.7–24.9

Seasonal swing summer↔winter8.60 °C

Max temp (day)24.7 °C 23.8–27.8

Min temp (night)20.9 °C 16.5–22.1

Precipitation142 mm/mo 97.8–183

Air humidity61.6 % 59.3–63.7

Vapour deficit1,033 Pa 908–1,171

Cloud cover30.2 % 26.0–40.7

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)