Ochotona dauurica

(Pallas, 1776) · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Lagomorpha/Ochotonidae/Ochotona

At a glance

Occurrence records175

Data sources9

Biological traits18

DNA specimens21

eDNA detections24

Sources9 archives

Databases and archives Ochotona dauurica's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF175 records

Environmental DNA1 datasets · 3 countries24 detections

DNA & barcodingBOLD21 specimens

01Narrative

Daurian pika in Arkhangai Province, Mongolia The Daurian pika (Ochotona dauurica) is a small relative of rabbits and hares in the order Lagomorpha. It is well known for its “barking” alarm call, and for its peculiar habit of making hay to help survive the winter. There are 4 recognized subspecies, Ochotona dauurica annectens, O.d. bedfordi, O.d. dauurica, and O.d. mursavi. Daurian pikas, like other lagomorphs, are characterized by a secondary set of incisor teeth. They are sexually monomorphic, with thick reddish coats. Pikas have no external tail, and their ears are large and rounded. The auditory bullae, a feature of the skull of daurian pikas are small in comparison to many other pikas. This is thought to be related to their fairly low altitude habitat preference. They are considered keystone species within their habitat.Liao, J., Z. Zhang, and N. Liu. "Effects Of Altitudinal Change On The Auditory Bulla In Ochotona Daurica (Mammalia, Lagomorpha)." Journal of zoological systematics and evolutionary research 45.2 (2007): 151-154. Print

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAmnioteDBEltonTraits

Size & morphology3

Body mass131 g

⚠ sources differ — PanTHERIA: 131 g · AmnioteDB: 128 g · EltonTraits: 109 g

Head body length180 mm

SVL18 cm

Life cycle & reproduction5

Age at sexual maturity94.39 days

⚠ sources differ — PanTHERIA: 94.39 days · AmnioteDB: 57.85 days

Gestation30 days

Litter size5.91

Litters per year2.25 /year

⚠ sources differ — PanTHERIA: 2.25 /year · AmnioteDB: 2.12 /year

Max. longevity14.0 months

Diet & foraging3

Breadth3

Plant other100 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth2

Terrestriality1.00

Physiology & chemistry2

Precipitation mean22.8 mm

Temperature mean-2.41 decidegC

Other traits3

Activity cycle-999.00

Foraging stratumG

Population density5 491 /km²

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochotona dauurica has left across the world's sequence archives.

At a glance

DNA specimens21

BINs3

Marker genes1

eDNA detections24

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

21Cmostly conserved

27Gmostly conserved

36Amostly conserved

42Cmostly conserved

48Amostly conserved

57Tmostly conserved

75Cmostly conserved

84Tvariable

93Tmostly conserved

99Cmostly conserved

102Cmostly conserved

135Cmostly conserved

159Amostly conserved

177Tvariable

180Gmostly conserved

192Cmostly conserved

204Tmostly conserved

205Cmostly conserved

219Tmostly conserved

223Gmostly conserved

234Cmostly conserved

246Cmostly conserved

249Tvariable

264Cmostly conserved

265Cmostly conserved

270Cmostly conserved

276Tmostly conserved

279Tmostly conserved

288Tmostly conserved

294Cmostly conserved

309Avariable

315Tmostly conserved

336Amostly conserved

339Cmostly conserved

342Cmostly conserved

345Tmostly conserved

366Cmostly conserved

405Cmostly conserved

417Amostly conserved

423Amostly conserved

447Cmostly conserved

449Cmostly conserved

450Gmostly conserved

456Tmostly conserved

462Tmostly conserved

465Gmostly conserved

483Cvariable

486Gmostly conserved

498Cmostly conserved

499Tmostly conserved

501Amostly conserved

504Cmostly conserved

505Gmostly conserved

519Cmostly conserved

525Amostly conserved

537Tmostly conserved

540Amostly conserved

543Tmostly conserved

555Cmostly conserved

567Tvariable

573Cmostly conserved

576Gmostly conserved

580Cmostly conserved

588Tmostly conserved

595Tmostly conserved

597Amostly conserved

612Cmostly conserved

642Cmostly conserved

ACCTTATATATGCTATTCGGCGCATGGGCCGGAATAGTGGGCACTGCACTCAGCCTTCTTATTCGAGCTGAACTCGGTCAACCTGGAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes11

BINs3

Most divergent pair8.8%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ochotona thibetanasame genus6.5%Ochotona curzoniaesame genus8.3%Ochotona cansussame genus8.5%Ochotona thomasisame genus9.0%Ochotona princepssame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_044120 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~4.66 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.66 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type175 records

Wild obs. + sensor104

Museum / vouchered71

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 44≤1 km 34≤10 km 3>10 km 3

84 georeferenced · 20 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 26≤1 km 1≤10 km 13>10 km 3

43 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
München, DE	23
CASlocation not on record	12
Paris, FR	7
Chicago, US	4
Wuzhou, CN	3
Helsinki, FI	3
Ann Arbor, US	2
Stockholm, SE	1

8 institutions · 55 of 71 vouchered records shown · 15 without an institution code

09Environmental DNA24 detections

Where the DNA of Ochotona dauurica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 11.5–19.8

Seasonal swing summer↔winter39.9 °C

Max temp (day)17.6 °C 17.4–24.6

Min temp (night)6.10 °C 5.20–14.6

Precipitation26.9 mm/mo 22.5–107

Air humidity52.1 % 50.0–56.9

Moisture balance-71.2 mm/mo -84.6–-30.5

Vapour deficit678 Pa 672–986

Wind speed4.00 m/s 2.50–4.10

Cloud cover41.5 % 33.5–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)