Ochlodes sylvanoides

(Boisduval, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Ochlodes

At a glance

Occurrence records21 007

Data sources8

Biological traits0

DNA specimens139

eDNA detections145

Sources8 archives

Databases and archives Ochlodes sylvanoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 007 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI145 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF21 007 records

Environmental DNA1 datasets · 2 countries145 detections

DNA & barcodingBOLD139 specimens

Genome at a glanceGoaT2n = 58

01Narrative

Ochlodes sylvanoides, the woodland skipper, is a butterfly of the family Hesperiidae. It is found in North America from British Columbia south to southern California, east to Montana, Colorado and Arizona. The wingspan is 25–32 mm. The upperside is orange with toothed brown borders. The forewing of the males has a black stigma, while females have or a black diagonal band. There is a large reddish patch on the hindwings. The underside is variable in colour, ranging from yellow to reddish to brown. The hindwing varies from unmarked to having a distinct band of cream to yellow spots. Adults feed on flower nectar. The larvae feed on various Poaceae species, including Cynodon dactylon, Phalaris, Elymus and Agropyron species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochlodes sylvanoides has left across the world's sequence archives.

At a glance

DNA specimens139

BINs1

Marker genes2

eDNA detections145

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus127 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

10Cmostly conserved

49Tmostly conserved

82Tmostly conserved

100Tvariable

367Cvariable

AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes25

BIN1

Most divergent pair2.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ochlodes agricolasame genus5.0%Pseudocopaeodes eunussame family5.2%Polites sabuletisame family5.5%Hesperia attalussame family5.5%Hesperia viridissame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Ochlodes sylvanoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 58 n = 29

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 291×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 581×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type21 007 records

Wild obs. + sensor19 278

Museum / vouchered1 127

Other602

Range

Area of Occupancy AOO30 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 10 005≤1 km 3 523≤10 km 1 235>10 km 750

15 513 georeferenced · 3 765 without coordinates

Open the mapobservation + sensor19 278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 45≤1 km 346≤10 km 374>10 km 136

901 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence1 127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Cruz, US	199
New Haven, US	187
Essig Museum of Entomologylocation not on record	169
OSUClocation not on record	110
Denver, US	93
Cambridge, US	70
WSUClocation not on record	46
Natural History Museum of Utahlocation not on record	35
East Lansing, US	29
San Diego, US	25
St. Paul, US	24
Cleveland Museum of Natural History, OH (CLEV)location not on record	17
WWUlocation not on record	17
Toronto, CA	15
Royal Saskatchewan Museumlocation not on record	13
Edmonton, CA	11
Helsinki, FI	7
University of Alberta Museums (UAM)location not on record	7
Philadelphia, US	6
Research Collection of Crispin S. Guppylocation not on record	6
Auckland, NZ	5
Tartu, EE	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Blacksburg, US	3
National Institute of Biological Resourceslocation not on record	3
Brussels, BE	2
Awka, NG	2
Colorado State Universitylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Wuzhou, CN	1
US	1
Universidad Católica de Manizaleslocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
SOVTlocation not on record	1
Champaign, US	1

35 institutions · 1 118 of 1 127 vouchered records shown · 9 without an institution code

09Environmental DNA145 detections

Where the DNA of Ochlodes sylvanoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found145

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 145 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestForestUplandMixed habitat4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 14.5–23.5

Seasonal swing summer↔winter14.9 °C

Max temp (day)23.6 °C 17.6–31.2

Min temp (night)14.7 °C 8.50–17.0

Precipitation13.3 mm/mo 0.8–37.1

Air humidity53.3 % 43.6–77.0

Moisture balance-114 mm/mo -165–-75.8

Vapour deficit885 Pa 425–1,437

Wind speed3.00 m/s 1.40–5.00

Cloud cover17.0 % 10.1–33.9

CHELSA 1981–2010, ~9 km grid, at location & month of 132 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ochlodes sylvanoides

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type21 007 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 007 records