Ochlodes agricola

(Boisduval, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Ochlodes

At a glance

Occurrence records2 331

Data sources7

Biological traits0

DNA specimens16

eDNA detections19

Sources7 archives

Databases and archives Ochlodes agricola's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 331 records

Environmental DNA1 datasets · 1 countries19 detections

DNA & barcodingBOLD16 specimens

01Narrative

Ochlodes agricola, the rural skipper, is a species of grass skipper in the butterfly family Hesperiidae. It is found in Central America and North America. The MONA or Hodges number for Ochlodes agricola is 4055.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ochlodes agricola has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections19

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

25Tvariable

37Amostly conserved

529Tvariable

574Gmostly conserved

601Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATACTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes4

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Polites egeremetsame family4.4%Polites themistoclessame family4.6%Polites othosame family4.7%Polites sabuletisame family4.7%Polites origenessame family5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 331 records

Wild obs. + sensor2 026

Museum / vouchered305

Range

Area of Occupancy AOO3 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 937≤1 km 464≤10 km 148>10 km 50

1 599 georeferenced · 427 without coordinates

Open the mapobservation + sensor2 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 6≤1 km 84≤10 km 132>10 km 40

262 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence305

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Essig Museum of Entomologylocation not on record	87
Santa Cruz, US	38
New Haven, US	37
Cambridge, US	33
OSUClocation not on record	29
WSUClocation not on record	28
East Lansing, US	24
St. Paul, US	9
Natural History Museum of Utahlocation not on record	7
San Diego, US	3
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
Tartu, EE	2
Philadelphia, US	2
Research Collection of Crispin S. Guppylocation not on record	1
Research Collection of Jen and Hilary Bayerlocation not on record	1
Blacksburg, US	1

16 institutions · 305 of 305 vouchered records shown

09Environmental DNA19 detections

Where the DNA of Ochlodes agricola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 16.4–22.1

Seasonal swing summer↔winter14.4 °C

Max temp (day)28.0 °C 22.9–31.0

Min temp (night)13.1 °C 10.2–14.7

Precipitation2.90 mm/mo 0.5–8.30

Air humidity53.1 % 44.0–60.8

Moisture balance-174 mm/mo -187–-148

Vapour deficit1,010 Pa 737–1,460

Wind speed2.60 m/s 1.80–3.60

Cloud cover22.7 % 10.6–33.3

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ochlodes agricola

At a glance

Sources7 archives

At a glance

Record type2 331 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 331 records