Oceanodroma tethys

(Bonaparte, 1852) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Procellariiformes/Hydrobatidae/Oceanodroma

At a glance

Occurrence records816

Data sources9

Biological traits27

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Oceanodroma tethys's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

OBISOcean Biodiversity Information System178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF · OBIS816 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · NCBI≈1.2 Gbp

01Narrative

The wedge-rumped storm petrel (Hydrobates tethys) is a storm petrel. It breeds in the Galápagos Islands and on the coast of Peru. It was formerly defined in the genus Oceanodroma before that genus was synonymized with Hydrobates.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAVONETAmnioteDBEltonTraitsSeaLifeBase

Size & morphology12

Beak depth3.5 mm

Beak length (culmen)13.3 mm

Beak length (nares)8.3 mm

Beak width2 mm

Body length20 cm

Body mass23.5 g

⚠ sources differ — AmnioteDB: 23.5 g · AVONET: 22.6 g · EltonTraits: 22.6 g · SeaLifeBase: 20 g

Hand-wing index59.4

Kipp's distance78.5 mm

Secondary length53.8 mm

Tail length58.8 mm

Tarsus length21.8 mm

Wing length130 mm

Life cycle & reproduction3

Egg mass5.7 g

Litter size1

Litters per year1 /year

Diet & foraging5

Fish40 %

Invertebrate60 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Water around surface100 %

Habitat & environment6

HabitatMarine

Habitat saltwateryes

Habitat zoneothers

Migration3.0

Primary lifestyleAerial

Range size11 745 532 km²

Other traits1

Vulnerability10

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oceanodroma tethys has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

286Gmostly conserved

472Tvariable

CCTATATCTAGTCTTTGGCGCATGAGCCGGCATAATCGGAACCGCTCTTAGCCTGCTTATCCGCGCGGAACTCGGCCAACCAGGAACCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes3

BIN1

Most divergent pair0.31%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oceanodroma leucorhoasame genus9.0%Oceanodroma furcatasame genus10.6%Oceanodroma matsudairaesame genus10.9%Oceanodroma monorhissame genus11.1%Oceanodroma tristramisame genus11.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_052782 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5CYTBND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Oceanodroma tethys carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 189 005 779 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Oceanodroma tethys1.19 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness95.5% BUSCO

08Occurrence & distribution

Record type816 records

Wild obs. + sensor361

Museum / vouchered455

Origin

Native268

Range

Area of Occupancy AOO1 072 km²

Depth

0–200 m sunlit22

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 3 m · 22 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 275≤10 km 19

294 georeferenced · 67 without coordinates

Open the mapobservation + sensor361

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 5≤10 km 4>10 km 1

10 georeferenced · 445 without coordinates

Open the institutions mapphysical evidence455

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	254
Washington, US	159
	9
Seattle, US	4
Honolulu, US	4
Universidad del Valle (UniValle)location not on record	3
Zacatecas, MX	3
Wuzhou, CN	2
Louisiana State University, Museum of Zoologylocation not on record	1
US	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Natural History Museum of Utahlocation not on record	1
CASlocation not on record	1

13 institutions · 443 of 455 vouchered records shown · 8 without an institution code

09Environmental DNA5 detections

Where the DNA of Oceanodroma tethys was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.6–25.8

Seasonal swing summer↔winter3.00 °C

Max temp (day)26.4 °C 26.0–26.5

Min temp (night)25.2 °C 25.1–25.2

Precipitation133 mm/mo 102–235

Air humidity65.6 % 65.1–66.8

Vapour deficit1,139 Pa 1,086–1,163

Cloud cover27.7 % 23.5–31.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)