Oceanodroma matsudairae

Kuroda, 1922 · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Procellariiformes/Hydrobatidae/Oceanodroma

At a glance

Occurrence records134

Data sources8

Biological traits27

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Oceanodroma matsudairae's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

OBISOcean Biodiversity Information System64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF · OBIS134 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Matsudaira's storm petrel (Hydrobates matsudairae) is a species of seabird in the family Hydrobatidae. It breeds solely in the Volcano Islands in the northwest Pacific Ocean, and winters in the Indian Ocean. Its common name and Latin binomial commemorate the Japanese ornithologist Yorikatsu Matsudaira. It was formerly defined in the genus Oceanodroma before that genus was synonymized with Hydrobates.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAmnioteDBAVONETSeaLifeBase

Size & morphology13

Beak depth4.8 mm

Beak length (culmen)20.1 mm

Beak length (nares)11.5 mm

Beak width3.4 mm

Body length25 cm

Body mass62 g

Body mass (male)62 g

Hand-wing index58.6

Kipp's distance108 mm

Secondary length76.5 mm

Tail length91 mm

Tarsus length25.2 mm

Wing length185 mm

Diet & foraging7

Fish30 %

Invertebrate60 %

Scavenge10 %

Trophic levelcarnivore

Trophic nicheAquatic predator

Water around surface80 %

Water below surface20 %

Habitat & environment6

HabitatMarine

Habitat saltwateryes

Habitat zoneothers

Migration3.0

Primary lifestyleAerial

Range size8.12 km²

Other traits1

Vulnerability15

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oceanodroma matsudairae has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P695 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.29%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

691Cvariable

693Tvariable

694Cvariable

CCTATACCTAATCTTTGGTGCATGAGCCGGCATAATCGGCACAGCCCTCAGCCTGCTTATTCGCGCAGAACTTGGCCAACCAGGGACCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oceanodroma monorhissame genus4.0%Oceanodroma leucorhoasame genus9.2%Oceanodroma tristramisame genus10.9%Oceanodroma castrosame genus11.4%Burhinus bistriatussame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type134 records

Wild obs. + sensor131

Museum / vouchered1

Other2

Range

Area of Occupancy AOO248 km²

Depth

0–200 m sunlit44

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 0 m · 44 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤1 km 89≤10 km 1>10 km 1

91 georeferenced · 40 without coordinates

Open the mapobservation + sensor131

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	1

1 institutions · 1 of 1 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Oceanodroma matsudairae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 16.8–23.2

Seasonal swing summer↔winter9.20 °C

Max temp (day)23.7 °C 19.7–23.9

Min temp (night)22.2 °C 12.8–22.4

Precipitation111 mm/mo 111–112

Air humidity61.5 % 59.9–61.6

Moisture balance27.7 mm/mo

Vapour deficit1,073 Pa 813–1,089

Wind speed5.40 m/s

Cloud cover45.1 % 44.5–45.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)