Norape virgo

(Butler, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Megalopygidae/Norape

At a glance

Occurrence records415

Data sources7

Biological traits0

DNA specimens10

eDNA detections7

Sources7 archives

Databases and archives Norape virgo's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility415 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF415 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Norape virgo is a moth of the Megalopygidae family. It was described by Arthur Gardiner Butler in 1877. It is found from southern Texas and southern Arizonamothphotographersgroup to Colombia. Adults are similar to Norape walkeri, but smaller. The forewings are shorter, broader and less glossy.Cistula Ent. 2: 203 The larvae feed on legumes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Norape virgo has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.88%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 14 variable positions, in barcode order

5Cmostly conserved

10Cmostly conserved

85Cmostly conserved

139Tmostly conserved

316Gmostly conserved

319Gmostly conserved

410Gvariable

451Cmostly conserved

484Cmostly conserved

508Gmostly conserved

571Cmostly conserved

574Tmostly conserved

625Amostly conserved

628Gmostly conserved

AACTCTATACTTTATTTTTGGAATTTGATCTGGTATATTAGGAACATCTTTAAGAATATTAATTCGAATAGAATTAGGAAATCCCAGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Norape ovinasame genus4.0%Norape sorpresasame genus6.4%Nephodia auxesiasame order11.6%Leptotes cassiussame order11.6%Europlema semibrunneasame order11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type415 records

Wild obs. + sensor377

Museum / vouchered38

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 203≤1 km 50≤10 km 6>10 km 69

328 georeferenced · 49 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 2≤10 km 3>10 km 2

7 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	20
New Haven, US	5
Smithsonian Institution, National Museum of Natural Historylocation not on record	5
Ciudad de México, MX	2

4 institutions · 32 of 38 vouchered records shown · 6 without an institution code

09Environmental DNA7 detections

Where the DNA of Norape virgo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–24.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)25.6 °C 25.6–29.6

Min temp (night)18.2 °C 18.2–19.4

Precipitation42.1 mm/mo 42.1–93.5

Air humidity58.9 % 55.2–58.9

Moisture balance-43.7 mm/mo -43.9–-43.7

Vapour deficit1,020 Pa 1,020–1,361

Wind speed3.10 m/s 2.20–3.10

Cloud cover32.7 % 22.3–32.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)