Norape ovina

(Sepp, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Megalopygidae/Norape

At a glance

Occurrence records167

Data sources7

Biological traits0

DNA specimens35

eDNA detections33

Sources7 archives

Databases and archives Norape ovina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF167 records

Environmental DNA1 datasets · 3 countries33 detections

DNA & barcodingBOLD35 specimens

01Narrative

Norape ovina, the white flannel moth, is a moth of the Megalopygidae family. In the United States, it is found from Washington, D.C. south to Florida, west to Montana and Texas. Its range extends further south through Mexico, Guatemala and Panama to Venezuela, Suriname and Bolivia. Eggs Pupa Damage Cocoon Adult This wingspan is 27–33 mm. Adults are on wing from April to May and from July to October. There are two per year in the north, likely more in south. The stinging larvae feed on hackberry and redbud.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Norape ovina has left across the world's sequence archives.

At a glance

DNA specimens35

BINs5

Marker genes2

eDNA detections33

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

5Tmostly conserved

31Tmostly conserved

34Avariable

49Tmostly conserved

85Tmostly conserved

100Tmostly conserved

127Cmostly conserved

131Gmostly conserved

133Tmostly conserved

142Tmostly conserved

154Tmostly conserved

197Cmostly conserved

199Tmostly conserved

200Avariable

202Tmostly conserved

205Amostly conserved

212Tmostly conserved

220Tmostly conserved

238Amostly conserved

266Cmostly conserved

268Cvariable

271Tvariable

274Cmostly conserved

277Tmostly conserved

280Tmostly conserved

286Tmostly conserved

287Tmostly conserved

295Amostly conserved

304Tmostly conserved

307Cvariable

313Tmostly conserved

316Amostly conserved

319Amostly conserved

337Amostly conserved

340Tvariable

343Tvariable

346Cmostly conserved

349Amostly conserved

355Tmostly conserved

370Gmostly conserved

373Amostly conserved

376Amostly conserved

379Tmostly conserved

400Cvariable

401Tmostly conserved

403Amostly conserved

406Cmostly conserved

415Amostly conserved

421Tmostly conserved

433Gvariable

442Tmostly conserved

451Tmostly conserved

460Tmostly conserved

472Tmostly conserved

475Tmostly conserved

484Tmostly conserved

485Tmostly conserved

499Tmostly conserved

506Gmostly conserved

508Gvariable

526Tmostly conserved

529Amostly conserved

532Amostly conserved

533Cmostly conserved

539Tmostly conserved

541Amostly conserved

547Amostly conserved

553Tmostly conserved

562Tmostly conserved

568Amostly conserved

571Tmostly conserved

574Tmostly conserved

578Tmostly conserved

580Amostly conserved

581Tmostly conserved

583Amostly conserved

586Amostly conserved

601Tmostly conserved

607Tmostly conserved

610Tmostly conserved

613Tmostly conserved

616Tmostly conserved

628Gmostly conserved

646Tmostly conserved

652Cmostly conserved

AACTTTATACTTTATTTTTGGAATTTGATCTGGAATATTAGGAACATCTTTAAGAATATTAATTCGAATAGAATTAGGAAATCCTAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes10

BINs5

Most divergent pair16.9%

N.AmericaOtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Norape virgosame genus4.0%Norape sorpresasame genus5.5%Polymixis atossasame order10.2%Lichenaula undulatellasame order10.3%Lithophane signosasame order10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type167 records

Wild obs. + sensor19

Museum / vouchered148

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy35% within 1 km

≤1 km 6≤10 km 7>10 km 4

17 georeferenced · 2 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 6≤10 km 28

34 georeferenced · 114 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	76
Washington, US	35
New Haven, US	7
The University of the West Indies, Trinidad and Tobagolocation not on record	3
Bernardino Rivadavia Natural Sciences Museumlocation not on record	1
Natural History Museum of Utahlocation not on record	1
Toronto, CA	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
ASUlocation not on record	1
University of California, Davislocation not on record	1

10 institutions · 127 of 148 vouchered records shown · 21 without an institution code

09Environmental DNA33 detections

Where the DNA of Norape ovina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map3 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 23.1–26.2

Seasonal swing summer↔winter19.8 °C

Max temp (day)30.1 °C 27.6–31.5

Min temp (night)21.9 °C 18.3–23.8

Precipitation125 mm/mo 111–333

Air humidity60.9 % 58.9–70.1

Moisture balance-23.3 mm/mo -72.8–184

Vapour deficit1,272 Pa 1,005–1,347

Wind speed2.30 m/s 1.50–3.80

Cloud cover31.1 % 28.6–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)