Noorda moringae

Tams, 1938 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Noorda

At a glance

Occurrence records2

Data sources6

Biological traits0

DNA specimens24

eDNA detections12

Sources6 archives

Databases and archives Noorda moringae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD24 specimens

01Narrative

Noorda moringae is een vlinder uit de familie van de grasmotten (Crambidae). De wetenschappelijke naam van de soort is voor het eerst gepubliceerd in 1938 door Willie Horace Thomas Tams. De soort komt voor in India.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Noorda moringae has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes15

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P625 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 8 variable positions, in barcode order

13Amostly conserved

14Amostly conserved

17Cmostly conserved

18Gmostly conserved

19Amostly conserved

460Gmostly conserved

568Tvariable

604Cmostly conserved

TTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Syngamia florellasame family6.9%Noorda blitealissame genus7.2%Depressaria ruticolasame order7.4%Piletocera aegimiusalissame family7.4%Synclera traducalissame family7.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type2 records

Wild obs. + sensor1

Museum / vouchered1

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA12 detections

Where the DNA of Noorda moringae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 25.3–27.5

Seasonal swing summer↔winter3.30 °C

Max temp (day)29.0 °C 28.2–30.7

Min temp (night)23.6 °C 19.5–26.5

Precipitation125 mm/mo 32.1–177

Air humidity62.4 % 55.0–63.8

Vapour deficit1,322 Pa 1,278–1,486

Cloud cover50.7 % 14.7–69.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)