Nigma puella

(Simon, 1870) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Dictynidae/Nigma

At a glance

Occurrence records3 789

Data sources9

Biological traits12

DNA specimens15

eDNA detections2

Sources9 archives

Databases and archives Nigma puella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 789 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

World Spider Trait DBMasaryk University12 traits · 9 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements9 literature sources12 traits

Occurrence & distributionGBIF3 789 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD15 specimens

01Narrative

Nigma puella is a species of spider belonging to the family Dictynidae. It is found in Europe, Azores, Madeira, Canary Islands and parts of North Africa. Like most members of the family, this is a small spider but the female is striking, with a light green abdomen marked with a bold maroon blotch and a variable amount of barring in the same colour. The male is reddish brown. This species makes a horizontal web over the top surface of a leaf.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 9 sources

Simonneau et al. 2016Macías-Hernández et al. 2020Harvey et al. 2017Finch 2004Buchholz et al. 2011Blick et al. 2016Nährig et al. 2003Nentwig et al. 2018Cardoso et al. 2011

Morphometry6

Body length♀2.48·♂2.04 mm

Cephalothorax height♀0.58·♂0.62 mm

Cephalothorax length♀0.97·♂0.83 mm

Cephalothorax width♀0.95·♂0.72 mm

Fang length♀0.18·♂0.19 mm

Tibia I length♀0.5·♂0.72 mm

Predation1

Hunting guildspace web weavers

Ecology5

Ballooningyes

Circadian activity0.43 mm

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryGenerally Threatened (G)

Stratum0.88 mm

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigma puella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs3

Marker genes1

eDNA detections2

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 95 variable positions, in barcode order

9Tmostly conserved

14Amostly conserved

23Tmostly conserved

32Tmostly conserved

35Amostly conserved

38Gmostly conserved

41Cmostly conserved

56Cmostly conserved

59Amostly conserved

65Amostly conserved

68Tmostly conserved

71Amostly conserved

72Tmostly conserved

74Amostly conserved

77Amostly conserved

80Gmostly conserved

83Cmostly conserved

89Amostly conserved

95Amostly conserved

98Gmostly conserved

101Cmostly conserved

108Cmostly conserved

110Tmostly conserved

134Tmostly conserved

146Amostly conserved

158Gmostly conserved

173Gmostly conserved

179Gmostly conserved

182Gmostly conserved

188Amostly conserved

194Amostly conserved

197Gmostly conserved

200Tmostly conserved

209Amostly conserved

218Tvariable

221Amostly conserved

227Amostly conserved

233Cmostly conserved

239Amostly conserved

242Amostly conserved

251Gmostly conserved

260Gmostly conserved

263Amostly conserved

266Amostly conserved

281Tmostly conserved

284Amostly conserved

287Avariable

304Tmostly conserved

311Amostly conserved

317Amostly conserved

323Cmostly conserved

326Tmostly conserved

329Gmostly conserved

338Tmostly conserved

350Tmostly conserved

353Cmostly conserved

359Tmostly conserved

362Tmostly conserved

368Tmostly conserved

377Tmostly conserved

380Amostly conserved

399Tmostly conserved

401Amostly conserved

405Cmostly conserved

407Amostly conserved

410Tmostly conserved

416Tmostly conserved

431Gmostly conserved

449Cmostly conserved

456Amostly conserved

476Amostly conserved

479Gmostly conserved

485Amostly conserved

491Gmostly conserved

497Gmostly conserved

500Amostly conserved

509Amostly conserved

515Tmostly conserved

533Amostly conserved

537Tmostly conserved

539Amostly conserved

540Cmostly conserved

542Amostly conserved

560Amostly conserved

563Amostly conserved

569Cmostly conserved

581Gmostly conserved

584Gmostly conserved

590Tmostly conserved

602Tmostly conserved

614Cmostly conserved

620Avariable

626Amostly conserved

632Cmostly conserved

653Gmostly conserved

CTTTATATTTATTATTTGGAGCTTGATCGGCTATAGTGGGCACTGCTATAAGTGTCCTAATTCGAATTGAATTAGGACAGCCCGGAAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes6

BINs3

Most divergent pair13.1%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nigma flavescenssame genus11.3%Tricholathys rothisame order13.3%Rualena cruzanasame order13.3%Uloborus glomosussame order13.4%Leprolochus birabenisame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 789 records

Wild obs. + sensor3 383

Museum / vouchered388

Other18

Origin

Native2

Introduced250

Range

Area of Occupancy AOO7 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 962≤1 km 829≤10 km 656>10 km 66

2 513 georeferenced · 870 without coordinates

Open the mapobservation + sensor3 383

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 262≤10 km 67>10 km 6

335 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence388

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	258
FETSlocation not on record	2
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	2
CIBIOlocation not on record	1
Liverpool, GB	1
South Kensington, GB	1
Frankfurt am Main	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

8 institutions · 267 of 388 vouchered records shown · 121 without an institution code

09Environmental DNA2 detections

Where the DNA of Nigma puella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 12.8–16.5

Seasonal swing summer↔winter17.4 °C

Max temp (day)18.7 °C 17.9–19.5

Min temp (night)9.70 °C 6.50–12.9

Precipitation90.5 mm/mo 63.2–118

Air humidity56.9 % 55.8–58.0

Vapour deficit724 Pa 658–789

Cloud cover34.5 % 28.2–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nigma puella

At a glance

Sources9 archives

Morphometry6

Predation1

Ecology5

At a glance

Record type3 789 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 789 records