Nigma flavescens

(Walckenaer, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Dictynidae/Nigma

At a glance

Occurrence records2 664

Data sources9

Biological traits12

DNA specimens25

eDNA detections21

Sources9 archives

Databases and archives Nigma flavescens's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 664 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

World Spider Trait DBMasaryk University12 traits · 20 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements20 literature sources12 traits

Occurrence & distributionGBIF2 664 records

Environmental DNA1 datasets · 4 countries21 detections

DNA & barcodingBOLD25 specimens

01Narrative

Die Gelbe Kräuselspinne (Nigma flavescens), auch Gelbliche Lauerspinne genannt, ist eine Webspinne aus der Familie Kräuselspinnen (Dictynidae). Sie ist in weiten Teilen Europas verbreitet.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 20 sources

Michalik & Ramirez 2014Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Liste France 2018Gajdoš et al. 2014Staręga et al. 2001Maelfait et al. 1998Řezáč et al. 2015Blick et al. 2016Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀3.65·♂2.5 mm

Predation2

Hunting guildspace web weavers

Simple hunting guild classificationweb-building

Ecology8

Ballooninghigh

Light0.5 mm

Light 2partly shaded

Moisture 10.75 mm

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categorySave or at low risk (SA)

Stratumvegetation

Anatomy1

Sperm transfer formcleistospermia

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nigma flavescens has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes2

eDNA detections21

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

127Gvariable

361Gmostly conserved

478Avariable

GACTTTATATTTTTTGTTTGGAGCTTGGGCAGCTATGGTTGGAACTGCTATAAGTGTATTAATTCGAATTGAATTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes5

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paradictyna ilamiasame family10.8%Nigma walckenaerisame genus11.1%Nigma puellasame genus11.3%Euryopis pepinisame order12.2%Theridion stannardisame order12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 664 records

Wild obs. + sensor2 193

Museum / vouchered470

Cultivated / captive1

Origin

Native151

Range

Area of Occupancy AOO5 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 431≤1 km 368≤10 km 1 026>10 km 15

1 840 georeferenced · 353 without coordinates

Open the mapobservation + sensor2 193

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 17≤10 km 246>10 km 1

264 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence470

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	130
Bonn, DE	39
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	35
Adam Mickiewicz University in Poznańlocation not on record	28
Frankfurt am Main	23
SNSDlocation not on record	15
	6
Tilburg, NL	6
Bern, CH	6
Paro, BT	3
ARTlocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
ZSMlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Senckenberg Museum fuer Naturkunde Goerlitzlocation not on record	1
Zoologisches Museum Hamburglocation not on record	1
Uniwersytet w Białymstokulocation not on record	1

19 institutions · 305 of 470 vouchered records shown · 165 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA21 detections

Where the DNA of Nigma flavescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map4 countries0

Sandiger Rand ehem. KiesgrubeFelswaldLas nad wodaUrbanWaldrand an Wiese, auf Laubzweigen

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.3 °C 8.80–17.1

Seasonal swing summer↔winter16.8 °C

Max temp (day)17.4 °C 13.1–21.2

Min temp (night)8.30 °C 3.60–12.6

Precipitation65.5 mm/mo 36.1–78.3

Air humidity59.1 % 57.8–61.0

Moisture balance-44.3 mm/mo -53.3–-23.8

Vapour deficit629 Pa 469–774

Wind speed3.80 m/s 2.90–4.60

Cloud cover35.5 % 31.2–41.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nigma flavescens

At a glance

Sources9 archives

Morphometry1

Predation2

Ecology8

Anatomy1

At a glance

Record type2 664 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 664 records