Nemapogon clematella

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tineidae/Nemapogon

At a glance

Occurrence records1 518

Data sources9

Biological traits0

DNA specimens36

eDNA detections31

Sources9 archives

Databases and archives Nemapogon clematella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 518 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 518 records

Environmental DNA1 datasets · 10 countries31 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · NCBI≈316 Mbp

01Narrative

Nemapogon clematella, the barred white clothes moth, is a moth of the family Tineidae. It is found in most of EuropeFauna Europaea and in North America, where it has been recorded from Maryland and North Carolina.mothphotographersgroup The habitat consists of woodlands.Hants Moths The wingspan is 12–15 mm. Adults are on wing from June to August. The larvae feed on fungi, including Hypoxylon fuscum and Fomes fomentarius, growing under the bark of dead twigs of elm, oak, beech and hawthorn.Nemapogon at funet The species overwinters in the larval stage. Pupation takes places in the fungus or wood.Lepidoptera of Belgium

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nemapogon clematella has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections31

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 43 variable positions, in barcode order

50Cmostly conserved

56Amostly conserved

81Tmostly conserved

91Amostly conserved

102Amostly conserved

106Tmostly conserved

118Tmostly conserved

217Tmostly conserved

226Tmostly conserved

232Gmostly conserved

241Tmostly conserved

271Cmostly conserved

295Tmostly conserved

302Gmostly conserved

312Amostly conserved

313Tmostly conserved

316Amostly conserved

337Tmostly conserved

343Tmostly conserved

352Amostly conserved

362Tmostly conserved

376Tmostly conserved

379Amostly conserved

382Tmostly conserved

391Amostly conserved

400Cmostly conserved

403Tmostly conserved

407Cmostly conserved

421Amostly conserved

428Cmostly conserved

433Amostly conserved

484Amostly conserved

487Amostly conserved

508Tmostly conserved

532Tmostly conserved

556Tmostly conserved

557Cmostly conserved

578Tmostly conserved

595Cmostly conserved

616Tmostly conserved

619Cmostly conserved

622Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCAAGAATAGTAGGTACTTCACTAAGAATTTTAATTCGAACTGAACTTAGTATTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs2

Most divergent pair6.7%

EuropeN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemapogon tylodessame genus7.0%Nemaxera betulinellasame family7.9%Nemapogon geniculatellasame genus8.7%Nemapogon cypricasame genus8.8%Nemapogon molybdanellasame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Nemapogon clematella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈315 617 496 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Nemapogon clematella0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.4% BUSCO

08Occurrence & distribution

Record type1 518 records

Wild obs. + sensor1 291

Museum / vouchered202

Other25

Origin

Native1

Range

Area of Occupancy AOO3 624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 602≤1 km 325≤10 km 252>10 km 16

1 195 georeferenced · 96 without coordinates

Open the mapobservation + sensor1 291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 51≤1 km 77≤10 km 11

139 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence202

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	33
Tartu, EE	26
Provincia di Livornolocation not on record	25
Cornell University Insect Collectionlocation not on record	24
SLU Artdatabankenlocation not on record	18
European Distributed Institute of Taxonomy (EDIT)location not on record	16
DanishLepidopterologicalSocietylocation not on record	12
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	6
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	6
Salzburg, AT	5
Stockholm, SE	3
Natural History Museum Rotterdamlocation not on record	3
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
NMBU:MINAlocation not on record	2
South Kensington, GB	2
Research Collection of Thomas Guggemooslocation not on record	1
BioFokuslocation not on record	1
Rovaniemi, FI	1

18 institutions · 186 of 202 vouchered records shown · 16 without an institution code

09Environmental DNA31 detections

Where the DNA of Nemapogon clematella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map10 countries0

1.1. Boreal Forest|1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 8.00–19.3

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.7 °C 11.6–23.7

Min temp (night)10.2 °C 4.20–14.5

Precipitation87.2 mm/mo 45.8–157

Air humidity60.4 % 57.9–63.8

Moisture balance-30.5 mm/mo -70.8–71.2

Vapour deficit696 Pa 406–958

Wind speed3.10 m/s 2.00–4.90

Cloud cover38.1 % 32.1–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Nemapogon clematella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 518 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 518 records