Nebria sahlbergii

Fischer von Waldheim, 1828 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records768

Data sources6

Biological traits0

DNA specimens22

eDNA detections3

Sources6 archives

Databases and archives Nebria sahlbergii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility768 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF768 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD22 specimens

01Narrative

Nebria sahlbergi is een keversoort uit de familie van de loopkevers (Carabidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1828 door Fischer von Waldheim.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria sahlbergii has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes2

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

187Cmostly conserved

205Tmostly conserved

316Amostly conserved

400Cmostly conserved

418Avariable

433Tvariable

538Amostly conserved

616Cmostly conserved

631Amostly conserved

AACTTTATATTTTATTTTTGGTACTTGAGCAGGAATAATTGGAACCTCTTTAAGAATATTAATTCGTGCAGAATTAGGTAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.36%

Haplotypes7

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria obliquasame genus6.5%Nebria suturalissame genus6.5%Nebria mannerheimiisame genus6.8%Nebria appalachiasame genus7.1%Nebria eschscholtziisame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type768 records

Wild obs. + sensor9

Museum / vouchered759

Range

Area of Occupancy AOO480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 3≤1 km 2>10 km 3

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 152≤1 km 28≤10 km 7>10 km 22

209 georeferenced · 550 without coordinates

Open the institutions mapphysical evidence759

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	531
Edmonton, CA	179
Cambridge, US	19
Royal Saskatchewan Museumlocation not on record	9
Colorado State Universitylocation not on record	6
Helsinki, FI	3
Provo, US	3
Natural History Museum of Utahlocation not on record	2

8 institutions · 752 of 759 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Nebria sahlbergii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.80 °C 4.20–7.20

Seasonal swing summer↔winter20.6 °C

Max temp (day)10.1 °C 9.90–13.3

Min temp (night)0.4 °C -1.60–1.70

Precipitation102 mm/mo 62.0–218

Air humidity52.5 % 51.3–59.2

Moisture balance8.70 mm/mo -27.1–146

Vapour deficit503 Pa 392–582

Wind speed2.50 m/s 2.30–3.40

Cloud cover42.8 % 36.2–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)