Nebria eschscholtzii

Ménétriés, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records745

Data sources6

Biological traits0

DNA specimens13

eDNA detections11

Sources6 archives

Databases and archives Nebria eschscholtzii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility745 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF745 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD13 specimens

01Narrative

Nebria eschscholtzii is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria eschscholtzii has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

28Gmostly conserved

202Cmostly conserved

433Tvariable

631Amostly conserved

AACTTTATATTTTATTTTTGGAACTTGGGCAGGAATAATTGGCACTTCTTTAAGAATTTTAATTCGTGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria diversasame genus2.1%Nebria obliquasame genus2.3%Nebria suturalissame genus2.3%Nebria pallipessame genus3.2%Nebria mannerheimiisame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type745 records

Wild obs. + sensor65

Museum / vouchered680

Range

Area of Occupancy AOO684 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 41≤1 km 10≤10 km 4>10 km 6

61 georeferenced · 4 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 17≤10 km 62>10 km 21

100 georeferenced · 580 without coordinates

Open the institutions mapphysical evidence680

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	401
University of Alberta Museums (UAM)location not on record	126
Provo, US	34
Zürich, CH	30
OSUClocation not on record	19
University of Alabamalocation not on record	18
Santa Barbara Museum of Natural Historylocation not on record	17
San Diego, US	13
Cambridge, US	7
Royal Saskatchewan Museumlocation not on record	4
Colorado State Universitylocation not on record	4
Essig Museum of Entomologylocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

14 institutions · 678 of 680 vouchered records shown · 1 without an institution code

09Environmental DNA11 detections

Where the DNA of Nebria eschscholtzii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.10–18.2

Seasonal swing summer↔winter16.9 °C

Max temp (day)17.5 °C 14.4–23.9

Min temp (night)3.20 °C 1.90–14.1

Precipitation84.6 mm/mo 1.10–121

Air humidity53.6 % 37.8–57.3

Moisture balance-21.1 mm/mo -197–26.8

Vapour deficit722 Pa 512–1,299

Wind speed2.50 m/s 1.70–2.90

Cloud cover36.8 % 11.1–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)