Nebria pallipes

Say, 1823 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records413

Data sources6

Biological traits0

DNA specimens5

eDNA detections4

Sources6 archives

Databases and archives Nebria pallipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Nebria pallipes is a species of beetle in the family Carabidae found in eastern North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria pallipes has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes2

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

625Avariable

AACTTTATATTTTATTTTTGGTACTTGAGCAGGAATAATCGGAACTTCTTTAAGAATTTTAATTCGTGCAGAATTAGGTAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria suturalissame genus3.0%Nebria eschscholtziisame genus3.2%Nebria obliquasame genus3.3%Nebria diversasame genus3.3%Nebria appalachiasame genus3.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor37

Museum / vouchered376

Range

Area of Occupancy AOO1 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 21≤1 km 4≤10 km 1>10 km 2

28 georeferenced · 9 without coordinates

Open the mapobservation + sensor37

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 5≤1 km 29≤10 km 183>10 km 17

234 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence376

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	88
OSUClocation not on record	38
Zürich, CH	16
University Park, US	16
Provo, US	14
SOVTlocation not on record	10
Espace pour la vielocation not on record	8
Cambridge, US	7
Saint John, CA	7
Natural History Museum of Utahlocation not on record	6
Colorado State Universitylocation not on record	5
UDlocation not on record	5
Royal Saskatchewan Museumlocation not on record	4
University of Alabamalocation not on record	3
Champaign, US	2
Chicago, US	1
Albuquerque, US	1
CUlocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
EWIClocation not on record	1

20 institutions · 234 of 376 vouchered records shown · 141 without an institution code

09Environmental DNA4 detections

Where the DNA of Nebria pallipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 10.8–13.7

Seasonal swing summer↔winter24.4 °C

Max temp (day)18.7 °C 15.1–18.7

Min temp (night)9.00 °C 5.60–9.00

Precipitation93.5 mm/mo 93.5–145

Air humidity56.4 % 56.4–58.5

Moisture balance2.10 mm/mo 2.10–45.9

Vapour deficit772 Pa 561–772

Wind speed2.80 m/s

Cloud cover42.9 % 42.9–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)