Nebria livida

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Nebria

At a glance

Occurrence records896

Data sources6

Biological traits0

DNA specimens12

eDNA detections12

Sources6 archives

Databases and archives Nebria livida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility896 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF896 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT2n = 34

01Narrative

Nebria livida is a species of ground beetle with two subspecies: Nebria livida angulata Banninger, 1949 Nebria livida livida (Linnaeus, 1758) Nebria laticollis angulata is found in China, North Korea, and Russia. Nebria livida livida is native to the Palearctic realm. In Europe it is found in Austria, Belarus, Belgium, Great Britain including the Isle of Man, the Czech Republic, mainland Denmark, Estonia, Finland, mainland France, Germany, Hungary, Kaliningrad, Latvia, Liechtenstein, Moldova, mainland Norway, Poland, Romania, Russia, Slovakia, Sweden, Switzerland, the Netherlands and the Ukraine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Nebria livida has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes2

eDNA detections12

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

28Gmostly conserved

32Amostly conserved

79Gmostly conserved

133Cmostly conserved

181Tmostly conserved

190Amostly conserved

202Gmostly conserved

250Tmostly conserved

268Avariable

334Tmostly conserved

337Tmostly conserved

400Tmostly conserved

418Amostly conserved

544Gmostly conserved

550Gmostly conserved

589Tmostly conserved

634Cmostly conserved

637Amostly conserved

AACTTTATATTTTATTTTTGGAGCATGGGCAAGTATAGTAGGAACTTCTTTAAGAATATTAATTCGAGCTGAATTAGGGAATCCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.61%

Haplotypes4

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nebria arkansanasame genus10.5%Nebria lituyaesame genus10.5%Nebria acutasame genus10.6%Nebria sahlbergiisame genus10.6%Nebria charlottaesame genus10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Nebria livida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×GoaT · Animal Chromosome Counts Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type896 records

Wild obs. + sensor535

Museum / vouchered352

Fossil4

Other5

Range

Area of Occupancy AOO1 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 156≤1 km 206≤10 km 150>10 km 3

515 georeferenced · 20 without coordinates

Open the mapobservation + sensor535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 28≤1 km 127≤10 km 118>10 km 11

284 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence352

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	79
Tartu, EE	40
Natural History Museum Rotterdamlocation not on record	22
Provincia di Livornolocation not on record	19
Philadelphia, US	18
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	17
Helsinki, FI	17
Nijmegen, NL	14
Uniwersytet Wrocławskilocation not on record	9
Kuopio, FI	9
MZLUlocation not on record	8
Veterinary Laboratory Agencylocation not on record	7
Copenhagen, DK	6
Adam Mickiewicz University in Poznańlocation not on record	6
TMPMlocation not on record	5
Jyväskylä, FI	4
NTNU-VMlocation not on record	3
Tilburg, NL	3
NCMGlocation not on record	3
Department of Microbiology, Prince of Songkla Universitylocation not on record	3
FEBlocation not on record	2
IPEM TASlocation not on record	2
ZMAAlocation not on record	2
Tromsø, NO	2
Cambridge, US	2
Tallinn, EE	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
NMOKlocation not on record	1
IFR-DNFlocation not on record	1
ZSMlocation not on record	1

30 institutions · 307 of 352 vouchered records shown · 44 without an institution code

09Environmental DNA12 detections

Where the DNA of Nebria livida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 0.2–16.2

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.1 °C 6.00–18.8

Min temp (night)11.9 °C -5.10–14.9

Precipitation72.2 mm/mo 62.7–73.6

Air humidity61.4 % 60.1–64.1

Moisture balance-33.4 mm/mo -43.6–26.2

Vapour deficit691 Pa 317–717

Wind speed3.30 m/s 1.20–4.50

Cloud cover45.3 % 38.9–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)