Mompha lacteella

Stephens · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records792

Data sources7

Biological traits2

DNA specimens27

eDNA detections65

Sources7 archives

Databases and archives Mompha lacteella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility792 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF792 records

Environmental DNA4 datasets · 10 countries65 detections

DNA & barcodingBOLD27 specimens

01Narrative

Mompha lacteella is a moth in the family Momphidae found in Asia and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha lacteella has left across the world's sequence archives.

At a glance

DNA specimens27

BINs1

Marker genes1

eDNA detections65

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

379Avariable

424Avariable

607Cvariable

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATGGTAGGAACCTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes5

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mompha propinquellasame genus2.9%Mompha murtfeldtellasame genus3.3%Mompha conturbatellasame genus5.0%Mompha unifasciellasame genus5.0%Mompha subbistrigellasame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type792 records

Wild obs. + sensor551

Museum / vouchered220

Other21

Range

Area of Occupancy AOO2 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 238≤1 km 152≤10 km 118

508 georeferenced · 43 without coordinates

Open the mapobservation + sensor551

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 116≤1 km 74≤10 km 12>10 km 2

204 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence220

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	53
Rovaniemi, FI	24
SLU Artdatabankenlocation not on record	22
DanishLepidopterologicalSocietylocation not on record	17
Tartu, EE	11
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Tromsø, NO	6
Salzburg, AT	2
Trondheim, NO	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
Provincia di Livornolocation not on record	2
neflocation not on record	2
Oulu, FI	1
Kuopio, FI	1

14 institutions · 153 of 220 vouchered records shown · 67 without an institution code

09Environmental DNA65 detections

Where the DNA of Mompha lacteella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys4

Countries10

Verifiable raw sequence linked23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map10 countries0

UrbanForest edge (suburban)Bog edge in alpine birch forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 7.70–18.0

Seasonal swing summer↔winter19.8 °C

Max temp (day)18.2 °C 11.9–22.2

Min temp (night)10.4 °C 1.60–13.6

Precipitation88.8 mm/mo 61.2–176

Air humidity60.9 % 57.9–64.0

Moisture balance-8.90 mm/mo -60.2–82.4

Vapour deficit646 Pa 408–826

Wind speed3.00 m/s 1.90–4.30

Cloud cover42.4 % 36.6–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 63 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)