Mompha conturbatella

Hübner, 1819 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records3 305

Data sources7

Biological traits2

DNA specimens98

eDNA detections125

Sources7 archives

Databases and archives Mompha conturbatella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI125 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics98 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 305 records

Environmental DNA4 datasets · 9 countries125 detections

DNA & barcodingBOLD98 specimens

Genome at a glanceGoaT≈402 Mbp

01Narrative

Mompha conturbatella, also known as the fireweed mompha moth, is a moth in the family Momphidae found in Asia, Europe and North America. It was first described by Jacob Hübner in 1819.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding98 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha conturbatella has left across the world's sequence archives.

At a glance

DNA specimens98

BINs1

Marker genes2

eDNA detections125

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus87 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

292Tmostly conserved

349Gmostly conserved

AACATTATATTTTATTTTTGGCATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTGCTAATTCGAGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes10

BIN1

Most divergent pair1.1%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mompha ochraceellasame genus5.0%Mompha lacteellasame genus5.0%Mompha murtfeldtellasame genus5.0%Mompha unifasciellasame genus5.2%Mompha propinquellasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Mompha conturbatella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈402 442 208 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mompha conturbatella0.40 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type3 305 records

Wild obs. + sensor2 790

Museum / vouchered504

Other11

Range

Area of Occupancy AOO5 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 1 445≤1 km 559≤10 km 698>10 km 3

2 705 georeferenced · 85 without coordinates

Open the mapobservation + sensor2 790

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 248≤1 km 120≤10 km 26

394 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	82
Edmonton, CA	35
Kuopio, FI	32
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
Rovaniemi, FI	19
DanishLepidopterologicalSocietylocation not on record	18
SLU Artdatabankenlocation not on record	16
Provincia di Livornolocation not on record	14
Stockholm, SE	14
Tartu, EE	13
Garðabær, IS	13
Philadelphia, US	10
RMZlocation not on record	8
Washington, US	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
NTNU-VMlocation not on record	6
ZMAAlocation not on record	5
Cornell University Insect Collectionlocation not on record	4
Metsähallituslocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
University of Alaska Museumlocation not on record	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
ZSMlocation not on record	1
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1

26 institutions · 335 of 504 vouchered records shown · 169 without an institution code

09Environmental DNA125 detections

Where the DNA of Mompha conturbatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found125

Studies independent surveys4

Countries9

Verifiable raw sequence linked29

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 125 detections have coordinates

Open the map9 countries0

4. Native Grassland|4.1. Tundra1. Forest & Woodland|1.1. Boreal Forestwet bog1. Forest & WoodlandForestmixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 4.90–16.9

Seasonal swing summer↔winter24.1 °C

Max temp (day)18.3 °C 10.4–22.0

Min temp (night)10.2 °C 0.7–13.1

Precipitation88.5 mm/mo 53.7–138

Air humidity58.5 % 55.3–64.2

Moisture balance-13.5 mm/mo -60.2–43.4

Vapour deficit687 Pa 374–886

Wind speed2.60 m/s 1.20–7.20

Cloud cover49.2 % 34.9–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 120 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mompha conturbatella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 305 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 305 records