Mompha epilobiella

Römer, 1794 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records2 805

Data sources8

Biological traits0

DNA specimens122

eDNA detections171

Sources8 archives

Databases and archives Mompha epilobiella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI171 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics122 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 805 records

Environmental DNA4 datasets · 15 countries171 detections

DNA & barcodingBOLD122 specimens

Genome at a glanceGoaT · NCBI≈328 Mbp

01Narrative

De gewone wilgenroosjesmot is een vlinder uit de familie wilgenroosjesmotten (Momphidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1775 door Denis & Schiffermüller. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding122 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha epilobiella has left across the world's sequence archives.

At a glance

DNA specimens122

BINs1

Marker genes2

eDNA detections171

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

100Cmostly conserved

250Tmostly conserved

253Amostly conserved

347Tmostly conserved

427Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATGGTTGGAACCTCTTTAAGATTACTAATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes8

BIN1

Most divergent pair0.91%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mompha unifasciellasame genus4.4%Mompha definitellasame genus4.7%Mompha circumscriptellasame genus4.7%Mompha brevivittellasame genus4.7%Mompha glaucellasame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PH3

animal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Mompha epilobiella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈328 203 224 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Mompha epilobiella0.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.4% BUSCO

08Occurrence & distribution

Record type2 805 records

Wild obs. + sensor2 561

Museum / vouchered244

Range

Area of Occupancy AOO4 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 510≤1 km 194≤10 km 1 701>10 km 5

2 410 georeferenced · 151 without coordinates

Open the mapobservation + sensor2 561

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 154≤1 km 21≤10 km 26

201 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	197
South Kensington, GB	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Cornell University Insect Collectionlocation not on record	4
Natural History Museum, Londonlocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
ZSMlocation not on record	1

7 institutions · 216 of 244 vouchered records shown · 28 without an institution code

09Environmental DNA171 detections

Where the DNA of Mompha epilobiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found171

Studies independent surveys4

Countries15

Verifiable raw sequence linked33

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 171 detections have coordinates

Open the map15 countries0

GrasslandUrban5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…flooded meadow, salix treescoastal scrub, large Tamarixfarm

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 9.00–19.6

Seasonal swing summer↔winter17.9 °C

Max temp (day)19.7 °C 12.6–23.6

Min temp (night)12.9 °C 5.10–17.6

Precipitation71.9 mm/mo 48.6–95.5

Air humidity60.8 % 57.7–63.0

Moisture balance-53.7 mm/mo -69.4–8.40

Vapour deficit697 Pa 448–922

Wind speed4.00 m/s 2.80–5.50

Cloud cover40.0 % 36.1–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 170 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mompha epilobiella

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 805 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 805 records