Mompha circumscriptella

(Zeller, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Momphidae/Mompha

At a glance

Occurrence records367

Data sources7

Biological traits0

DNA specimens30

eDNA detections33

Sources7 archives

Databases and archives Mompha circumscriptella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility367 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF367 records

Environmental DNA1 datasets · 2 countries33 detections

DNA & barcodingBOLD30 specimens

01Narrative

Mompha circumscriptella, the circumscript mompha moth, is a moth in the family Momphidae. It is found in North America, where it has been recorded from Alabama, Arkansas, British Columbia, California, Florida, Georgia, Illinois, Indiana, Iowa, Kansas, Kentucky, Louisiana, Maine, Maryland, Mississippi, Missouri, Nebraska, New Jersey, North Carolina, Ohio, Oklahoma, South Carolina, Tennessee, Texas and West Virginia.mothphotographersgroup The wingspan is about 12 mm. Adults are narrow-winged with a distinctive forewing color pattern.Bug Guide The larvae feed on Oenothera species. They bore into the fruit of the host plant. Pupation takes place inside the fruit.Microleps.Org

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mompha circumscriptella has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

340Cvariable

506Gmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes7

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mompha definitellasame genus3.4%Mompha unifasciellasame genus3.8%Mompha epilobiellasame genus4.7%Mompha brevivittellasame genus5.0%Mompha murtfeldtellasame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type367 records

Wild obs. + sensor280

Museum / vouchered87

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 136≤1 km 55≤10 km 5>10 km 30

226 georeferenced · 54 without coordinates

Open the mapobservation + sensor280

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 3≤10 km 9>10 km 1

13 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	61
Washington, US	7
King Saud Universitylocation not on record	4
CUlocation not on record	2
Cornell University Insect Collectionlocation not on record	2
Cambridge, US	1
US	1

7 institutions · 78 of 87 vouchered records shown · 9 without an institution code

09Environmental DNA33 detections

Where the DNA of Mompha circumscriptella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 10.7–28.8

Seasonal swing summer↔winter21.5 °C

Max temp (day)26.8 °C 15.5–34.0

Min temp (night)16.1 °C 6.60–24.3

Precipitation87.0 mm/mo 46.4–216

Air humidity56.3 % 51.5–62.1

Moisture balance-51.6 mm/mo -171–161

Vapour deficit1,183 Pa 533–1,841

Wind speed3.70 m/s 1.40–5.30

Cloud cover34.1 % 22.2–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)