Milax gagates

(Draparnaud, 1801) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Milacidae/Milax

At a glance

Occurrence records4 739

Data sources7

Biological traits2

DNA specimens20

eDNA detections0

Sources7 archives

Databases and archives Milax gagates's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 739 records↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF4 739 records

DNA & barcodingBOLD20 specimens

01Narrative

Milax gagates, known by the common name greenhouse slug, is a species of air-breathing, keeled, land slug, a shell-less terrestrial gastropod mollusc in the family Milacidae.Marshall, B. (2014). Milax gagates (Draparnaud, 1801). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=819993 on 2014-11-06

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Milax gagates has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes2

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)0.93%

Haplotypes1

BIN1

Where individuals differ — all 23 variable positions, in barcode order

98Gmostly conserved

124Amostly conserved

136Amostly conserved

160Amostly conserved

181Gvariable

196Gvariable

232Cmostly conserved

259Amostly conserved

262Amostly conserved

304Cmostly conserved

305Gmostly conserved

307Gmostly conserved

348Gmostly conserved

352Gvariable

370Avariable

379Cvariable

523Tmostly conserved

541Gvariable

556Amostly conserved

580Avariable

622Tmostly conserved

625Tmostly conserved

628Gvariable

AACTTTATATATAATTTTTGGTGTATGGTGTGGTATAGTTGGTACAGGTTTATCTTTATTAATTCGTTTAGAATTAGGAACTGCTGGAGT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Milax nigricanssame genus6.9%Tandonia budapestensissame family10.4%Parmarion martensisame order10.6%Eucobresia nivalissame order11.0%Vitrinobrachium brevesame order11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type4 739 records

Wild obs. + sensor4 138

Museum / vouchered601

Origin

Native5

Introduced3

Range

Area of Occupancy AOO12 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1 582≤1 km 780≤10 km 871>10 km 272

3 505 georeferenced · 633 without coordinates

Open the mapobservation + sensor4 138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 26≤1 km 11≤10 km 52>10 km 8

97 georeferenced · 504 without coordinates

Open the institutions mapphysical evidence601

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	351
Wellington, NZ	80
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	28
Philadelphia, US	27
Los Angeles, US	16
QVMAGlocation not on record	15
Santa Barbara Museum of Natural Historylocation not on record	11
Cambridge, US	7
Tasmanian Museum & Art Gallerylocation not on record	6
CASlocation not on record	5
Natick, US	4
Barcelona, ES	3
North Carolina Museum of Natural Scienceslocation not on record	3
Bern, CH	2
Western Australian Museumlocation not on record	2
South Kensington, GB	2
Chongqing Museumlocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	1
Auckland, NZ	1
Washington, US	1
Paris, FR	1
Helsinki, FI	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
BioFokuslocation not on record	1
Sydney, AU	1

25 institutions · 572 of 601 vouchered records shown · 29 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Milax gagates

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type4 739 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Record type4 739 records