Parmarion martensi

Simroth, 1893 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Ariophantidae/Parmarion

At a glance

Occurrence records1 430

Data sources6

Biological traits0

DNA specimens14

eDNA detections3

Sources6 archives

Databases and archives Parmarion martensi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 430 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD14 specimens

01Narrative

Parmarion martensi is a species of air-breathing land semislug, a terrestrial pulmonate gastropod mollusk in the family Ariophantidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Parmarion martensi has left across the world's sequence archives.

At a glance

DNA specimens14

BINs7

Marker genes1

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P601 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 115 variable positions, in barcode order

7Tmostly conserved

13Avariable

19Avariable

22Tvariable

28Tvariable

31Amostly conserved

32Tmostly conserved

34Amostly conserved

40Amostly conserved

43Amostly conserved

46Amostly conserved

47Tmostly conserved

49Amostly conserved

58Tmostly conserved

61Avariable

64Avariable

67Amostly conserved

70Gvariable

91Avariable

97Avariable

103Tmostly conserved

136Amostly conserved

140Amostly conserved

151Tmostly conserved

154Amostly conserved

160Tvariable

172Amostly conserved

175Tmostly conserved

178Amostly conserved

179Tmostly conserved

187Tmostly conserved

193Tmostly conserved

196Tvariable

202Amostly conserved

205Tvariable

226Gvariable

232Amostly conserved

233Tmostly conserved

235Amostly conserved

241Tmostly conserved

259Amostly conserved

263Tmostly conserved

264Gmostly conserved

265Tmostly conserved

268Amostly conserved

271Amostly conserved

274Gmostly conserved

277Tmostly conserved

280Amostly conserved

283Tvariable

286Avariable

289Tvariable

292Avariable

298Tmostly conserved

304Tvariable

307Amostly conserved

310Cvariable

313Tvariable

316Tmostly conserved

325Tvariable

331Tmostly conserved

334Amostly conserved

340Tmostly conserved

346Tmostly conserved

349Tmostly conserved

352Amostly conserved

358Amostly conserved

361Amostly conserved

370Avariable

371Tmostly conserved

373Amostly conserved

379Amostly conserved

382Tmostly conserved

391Tmostly conserved

398Tmostly conserved

403Tmostly conserved

406Avariable

412Tmostly conserved

436Amostly conserved

439Avariable

440Tmostly conserved

442Tmostly conserved

443Cmostly conserved

445Avariable

446Gmostly conserved

448Tmostly conserved

453Cmostly conserved

457Amostly conserved

466Amostly conserved

468Gmostly conserved

469Amostly conserved

472Amostly conserved

478Amostly conserved

481Amostly conserved

484Amostly conserved

490Amostly conserved

493Tmostly conserved

512Tmostly conserved

517Tvariable

523Avariable

526Amostly conserved

527Tvariable

529Amostly conserved

532Tmostly conserved

535Avariable

538Tmostly conserved

541Tmostly conserved

544Tvariable

556Amostly conserved

562Amostly conserved

574Tvariable

577Amostly conserved

595Amostly conserved

598Avariable

601Amostly conserved

ATGTGGTATAGTAGGTACAGGTTTATCTTTATTAATTCGATTAGAATTAGGTACAGCTGGAGTATTATTGGATGATCATTTTTTTAATGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.8%

Haplotypes7

BINs7

Most divergent pair9.5%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Milax nigricanssame order9.7%Vitrinizonites latissimussame order10.1%Coneuplecta calculosasame order10.3%Pseudocharopa ledgbirdisame order10.3%Mystivagor mastersisame order10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 430 records

Wild obs. + sensor1 409

Museum / vouchered11

Other10

Range

Area of Occupancy AOO2 832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 618≤1 km 217≤10 km 85>10 km 85

1 005 georeferenced · 404 without coordinates

Open the mapobservation + sensor1 409

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Zoologicum Bogoriense, Bogorlocation not on record	3
Paris, FR	2
Honolulu, US	2
Kharazmi Universitylocation not on record	1
Guermonprez Museumlocation not on record	1

5 institutions · 9 of 11 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Parmarion martensi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Parmarion martensi

At a glance

Sources6 archives

At a glance

Record type1 430 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 430 records